Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for improving electricity generation of clostridium beijerinckii and application thereof

A technology of Clostridium beijerinckii and Clostridium beijerinckii electric is applied in the field of environment and new energy, which can solve the problems of unclear microbial electricity-generating mechanism and weak microbial electricity-generating ability, and achieves alleviation of energy crisis, low cost, electronic The effect of high recovery rate

Inactive Publication Date: 2018-01-19
CENTRAL SOUTH UNIVERSITY OF FORESTRY AND TECHNOLOGY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the mechanism of microbial electricity production is still unclear, and the reported microbial electricity production capacity is weak, which has become a bottleneck in the development of MFC electricity generation technology.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving electricity generation of clostridium beijerinckii and application thereof
  • Method for improving electricity generation of clostridium beijerinckii and application thereof
  • Method for improving electricity generation of clostridium beijerinckii and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] This example illustrates the construction method of the Clostridium beijerinckii Cbei_4110 gene insertion inactivation recombinant strain.

[0027] 1. Design intron sequence

[0028] According to the Cbei_4110 gene sequence of Clostridium beijerinckii included in the NCBI database (see SEQ ID NO: 1 in the sequence listing for details), a suitable insertion gene site is designed by means of software ( http: / / www.clostron.com ), select to be inserted between 392 and 393, and generate an intron sequence, synthesize the intron sequence S-392, its sequence is shown in SEQ ID NO: 2, and design primers:

[0029] pWJ-OSC-392-S

ggagtgtcgaggatc ctcgag ataattatccttagatgtctctaaag

pWJ-OSC-392-A

ggttctcctacagat tgtaca aatgtggtgataacagataag

Cbei-4110-T-S

aatcaattgctcctacactctgt

Cbei-4110-T-A

atgtcaaaatatatggtgattgat

[0030] The sequences thereof are respectively shown in SEQ ID NO: 3-6.

[0031] The two ends of primers pWJ-O...

Embodiment 2

[0045] This example illustrates the electricity production experiment using 1 g / L glucose by the high-electricity Clostridium beijerinckii constructed above as an anode catalyst.

[0046] (1) Construction of microbial fuel cells

[0047] In this example, a microbial fuel cell using Clostridium beijerinckii to generate electricity as an anode catalyst was established according to existing technologies and methods, including four parts: an anode chamber, a cathode chamber, a proton exchange membrane, and an external circuit. The anode electrode and cathode electrode are PAN-based graphite soft felt (5×5cm), with titanium wire as the external circuit, the external resistance is 1000Ω, the proton exchange membrane is DuPont NafionN117, and the data collector is Keithley series.

[0048] (2) Culture medium formula:

[0049] YPS seed medium: yeast powder 3g / L, peptone 5g / L, glucose 1g / L, ammonium acetate 2g / L, sodium chloride 3g / L, magnesium sulfate heptahydrate 3g / L, potassium dih...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to clostridium beijerinckii recombination strain with high electricity generating capability, which is obtained by carrying out insertional inactivation on gene Cbei_4110 encoding NADH-coenzyme Q oxidoreductase key subgroups in clostridium beijerinckii. The invention provides a simple and high-efficiency method for improving electricity generation of the clostridium beijerinckii. According to the recombination strain obtained by the method, when 1g / L of glucose seed liquid neutralizes 0.1g / L of methyl viologen (MV) into an electronic mediator, the maximum output voltage is 154.4mV and is 1.93 times that of an initial strain NCIMB 8052, and the maximum output power density is 65.8mW / m<2>, and is 1.23 times that of the initial strain NCIMB 8052. According to the method,the operation is convenient, no pollution exists, and the fuel utilization spectrum is wider. The clostridium beijerinckii with high electricity generation is an excellent strain suitable for research and application of microbial fuel cells.

Description

technical field [0001] The invention belongs to the technical field of environment and new energy, and relates to a method for increasing electricity production of Clostridium bejejerinckii and its application. Background technique [0002] Due to energy depletion, limited storage of fossil energy, and increasing demand for energy, more and more countries have realized the problem of energy shortage. At present, biofuel has become a very popular renewable green energy, and all countries in the world are vigorously developing biofuel. More and more scientific researchers hope to use microorganisms to generate electricity to solve the problem of energy shortage. At present, microbial fuel cell (Microbial Fuel Cell, MFC) technology is constantly improving. [0003] Most of the electrogenic microorganisms are anaerobic microorganisms, among which the high electrogenic microorganisms are mainly concentrated in two types of dissimilatory metal-reducing bacteria, Shewanella and G...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/74C12N1/21H01M8/16C12R1/145
CPCY02E60/50Y02P70/50
Inventor 郭亭刘俊罗运川柴雪莹林亲录杨涛
Owner CENTRAL SOUTH UNIVERSITY OF FORESTRY AND TECHNOLOGY