Application of Serum 16srDNA as a Biomarker of Diabetic Nephropathy
A serum and reagent technology, applied in the application field of biomarkers, can solve the problems of limited diabetic nephropathy and achieve the effect of easy sample acquisition, moderate molecular size, prevention and control of diabetic nephropathy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] The extraction of the serum 16S rDNA of embodiment 1 Prevotella, Clostridium tenebilis, Clostridium sphaericus and Streptococcus
[0029] The bacterial genomic DNA extraction kit (Qiagen) was used to extract 16S rDNA from Prevotella, Clostridium tenebilis, Clostridium sphaericus, and Streptococcus in serum samples, and the specific steps were as follows:
[0030] a. Take out the -80°C frozen sample and put it on ice to thaw, pipette 200 μL of serum into a 1.5 mL EP tube, add 200 μL of lysate and 20 μL of proteinase K to lyse the bacteria, vortex and mix well, and then centrifuge.
[0031] b. Place the mixed solution in a water bath at a constant temperature of 56°C for 15 minutes, dry it and spin off immediately.
[0032] c. Add 250 μL of absolute ethanol to the lysate, mix well, let stand at room temperature for 5 minutes, and centrifuge.
[0033] d. Transfer the lysate to an adsorption tube, cover the tube and let stand at room temperature for 5 minutes.
[0034] e....
Embodiment 2
[0043] The detection of embodiment 2 Prevotella, Clostridium tenebilis, Clostridium sphaericus and Streptococcus serum 16S rDNA
[0044] The 16S rDNA of the 4 kinds of bacteria in the serum samples extracted in Example 1 were detected respectively, and the specific methods were as follows:
[0045] (1) Quantify the 16S rDNA of Prevotella in the sample serum
[0046] For RT-PCR amplification of the 16S rDNA region of Prevotella serovar, use the following primers and probes, and configure the reaction system in the PCR tube according to Table 1:
[0047] Forward primer: CCTWCGATGGATAGGGGTT (SEQ ID No.1); wherein W represents A / T.
[0048] Reverse primer: CACGCTACTTGGCTGGTTCAG (SEQ ID No.2);
[0049] Probe: VIC-AAGGTCCCCACATTG (SEQ ID No. 9).
[0050] Table 1 reaction system
[0051]
[0052]
[0053] Centrifuge the PCR tube loaded with the sample at a low speed and put it into a real-time fluorescence quantitative PCR instrument for amplification. Reaction conditions ...
Embodiment 3
[0075] Example 3 Detection of 16SrDNA in blood serum of patients with diabetes mellitus and diabetic nephropathy
[0076] According to the method of embodiment 1-2, the 16S rDNA of Prevotella, Clostridium tenebilis, Clostridium sphaericus and Streptococcus in the serum of 100 cases of simple diabetes patients and 100 cases of diabetic nephropathy patients were analyzed and found that serum of patients with diabetic nephropathy The relative abundance of the four bacteria in the -ΔΔCt ) was significantly higher than that of the simple diabetes group, and the differences were statistically significant (P<0.05) (Table 4).
[0077] Table 4 Analysis of serum 16S rDNA levels in patients with simple diabetes and diabetic nephropathy
[0078]
[0079] The above results show that the detection reagent or detection kit for human diabetic nephropathy can be produced based on Prevotella, Clostridium tenebilis, Clostridium sphaericus and Streptococcus. The kit includes specific primers...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More