Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Mandarin fish gamma interferon relevant factor as well as recombinant protein and application thereof

A related factor, gamma interferon technology, applied in mandarin fish gamma interferon related factor and its recombinant protein and application field, can solve unseen problems

Active Publication Date: 2018-07-10
INST OF AQUATIC LIFE ACAD SINICA
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] There is no report on the sequence and function of IFN-γrel gene in mandarin fish

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mandarin fish gamma interferon relevant factor as well as recombinant protein and application thereof
  • Mandarin fish gamma interferon relevant factor as well as recombinant protein and application thereof
  • Mandarin fish gamma interferon relevant factor as well as recombinant protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Mandarin fish gamma interferon-related factor IFN-γrel ORF full-length preparation:

[0027] 1. Template Preparation

[0028] RNA was extracted from mandarin fish by Trizol method, and cDNA template was obtained by reverse transcription according to the operation steps of RevertAid First Strand cDNA Synthesis Kit (Thermo, K1622). 5'-RACE was prepared with 5'-Full RACE Kit, and 3'-RACE was prepared with SMARTTM RACE cDNA Amplification Kit. cDNA at the end of RACE.

[0029] 2. PCR amplification

[0030] Firstly, the degenerative primers Sc-IFN-γrelDF and Sc-IFN-γrelDR were used to amplify the intermediate fragment with cDNA as a template for sequencing verification, and SMART cDNA was obtained;

[0031] Degenerate primers for amplifying the middle fragment:

[0032] TPREL-F1BKB:5>ACRAWCGCATTTTCTCCAGCAT<3

[0033] TPREL-F2BKB:5>YAACACCTCCTGCCAGAGA<3

[0034] TPREL-R2BKB:5>ACTCAGCCAGAGCTCTCTTCTG<3

[0035] TPREL-R1BKB:5>CYWKGWACTCAGCCAGAGCT<3

[0036] TPREL-F3BKB:5>T...

Embodiment 2

[0050] Construction of IFN-γrel prokaryotic expression plasmid and protein purification

[0051] The software predicts that the IFN-γrel signal peptide is removed, and the forward and reverse primers are designed to use IFN-γrel-PEX-F with an EcoRI restriction site as the forward primer, and IFN-γrel-PEX-R with an XhoI restriction site Using PMD18T-IFN-γrel as a reverse primer, amplified fragments with enzyme cleavage sites were amplified. Then use EcoRI and XhoI two fast cutting enzymes to simultaneously digest the amplified target fragment and the pET28a(+) plasmid. After digestion, the IFN-γrel and pET28a(+) plasmids are ligated with T4 ligase at 25 degrees for 30 minutes, and enzymes at 65 degrees Inactivate for 10 minutes, and finally transform the ligation product into DE3 expression bacteria. After PCR and sequencing verification, the positive transformants successfully constructed IFN-γrel into the pET28a(+) expression vector, and the obtained strain was named pET28a(+...

Embodiment 3

[0064] Application of IFN-γrel Recombinant Protein in Preparation of Immunomodulator

[0065] The preparation of mandarin fish kidney leukocytes: first wet the 15ml centrifuge tube wall with bovine serum; add 4ml premixed 51% Percoll (2.04ml Percoll stock solution, 0.4ml NaCl, 1.54ml sterilized water, 800U Heparin) into the centrifuge tube ). When adding liquid, the 15ml centrifuge tube is tilted, and the tip of the 1ml pipette should be close to the tube wall, and the flow rate should be slow to prevent a large momentum. Then add 4ml premixed 34% Percoll (1.36ml Percoll stock solution, 0.4ml NaCl, 2.22ml sterilized water, 800U Heparin) in the same way.

[0066] The mandarin fish head kidney that will be taken out in aseptic environment is placed on the pre-cooled DMEM culture medium (containing 2% fetal bovine serum, 100U / ml penicillin, 100 μ g / ml streptomycin, 10U / ml Heparin) rapidly; Cut the head kidney into small pieces with scissors in Taichung, wash the tissue piece tw...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and concretely discloses a mandarin fish gamma interferon relevant factor as well as a recombinant protein and application thereof. By designing merging primer amplification to obtain an IFN-gammarel gene fragment, the amplification is performed by a race method to obtain a complete gene sequence; IFN-gammarel-ORF-F and IFN-gammarel-ORF-R are used as primers; mandarin fish head kidney intestine mixed tissue total RNA is used as a template to perform amplification so as to obtain a complete open reading frame of the IFN-gammarel gene; thenucleotide sequence is shown as SEQ ID NO.1; the corresponding coding amino acid sequence is shown as SEQ ID NO.2. Through primary verification, the IFN-gammarel recombinant protein can induce the up-regulated expression of immune related genes Mx, IRF1, STAT1 and SOCS1, and can be used as fish immunopotentiators or immunologic adjuvants.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to mandarin fish gamma interferon-related factors, recombinant proteins and applications thereof. Background technique [0002] In 1957, the British scientist Isaacs first discovered interferon (Interferon, IFN) when he used chicken embryo chorioallantoic membrane to study the interference phenomenon of influenza virus, and then found that it is an important role in innate immunity and acquired immunity. Cytokines have various functions such as inhibiting cell division, regulating immunity, anti-virus, and anti-tumor. Interferons are widely found in vertebrates. According to the gene structure, receptor type and function, it can be divided into type I, type II and type III. Currently, only type I and type II interferons are found in fish, and no type III interferon has been reported so far. [0003] Mammalian type II interferons have only one member, interferon-gamma (IFN...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/57C12N15/23C12N15/11C12N15/70A61K38/21A61P37/04
CPCA61K38/00C07K14/57C12N15/70
Inventor 聂品李丽陈善楠李楠
Owner INST OF AQUATIC LIFE ACAD SINICA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com