64 results about "Immune related genes" patented technology

The invention relates to an immune gene prognosis model for predicting hepatocellular carcinoma tumor immune infiltration and postoperative survival time, and belongs to the technical field of biological medicines. The model can be used for evaluating the infiltration degree of immune cells in a tumor in clinical practice by detecting the expression levels of 22 specific immune related genes of ahepatocellular carcinoma patient, so that the model can be used for predicting hepatocellular carcinoma tumor immune infiltration in clinical practice and improve the prediction capability of the liver cancer immunotherapy response. The model can be used for judging the postoperative overall survival risk of a patient and guiding the formulation of a postoperative treatment strategy, and the corresponding microarray chip kit can realize the standardization and convenience of detection. Meanwhile, the immune gene prognosis model provided by the invention can increase the prediction accuracy andthe clinical net income of a hepatocellular carcinoma TNM staging system on the total survival time of three years and five years after operation. As a molecular marker for objectively and accuratelyevaluating the tumor immune state and poor prognosis risk of hepatocellular carcinoma, the model can realize accurate implementation of hepatocellular carcinoma immunotherapy and accurate prognosis prediction.

The invention discloses a method for establishing an immunodeficiency mouse model. The method comprises the following steps of: (1) constructing DNA (deoxyribonucleic acid) which enables functions of an immune related gene in a mouse cell to be lost; (2) purifying mRNA (messenger ribonucleic acid), and cryopreserving in a super-purified water of RNAase free; (4) feeding a pregnant female mouse and a pseudopregnant female mouse under an SPF (specific pathogen free) level feeding condition; (5) taking a fallopian tube from the abdominal cavity of the pregnant female mouse in the step (4), and collecting fertilized ovum; (6) injecting the mRNA obtained in the step (3) into the pronucleus of the fertilized ovum in the step (5) by using a microinjection method; (7) transplanting the fertilized ovum obtained in the step (6) into the body of the pseudopregnant female mouse obtained in the step (4), and enabling the pseudopregnant female mouse to culture the second generation; (8) establishing a stable deficient mouse strain. The method has the advantages that a mouse model which completely does not have immunological rejection to allotransplantation can be obtained for testing.

The present invention provides a novel DNA microarray chip that can be used for simultaneous testing of transcriptional responses to cutaneous stressors in the context of neuro-endocrine-immune functions of the skin. The transcriptional responses to ultraviolet radiation in epidermal keratinocytes were tested using such microarray chip containing more than 700 neuro-endocrine-immune related genes. The gene expression pattern was non-random and time dependent; it included increased expression of genes involved in water and salt balance, prostaglandin synthesis, keratinocyte differentiation as well as genes coding for stress effectors, cytokines and metalloproteinases. In contrast, expression was decreased for genes coding for growth factors and their receptors, and for elements of extracellular matrix. This stochastic pattern suggests that transcriptional responses are coordinated and aimed at preservation of epidermal barrier function, prevention of early carcinogenic events and remodeling of extracellular matrix.

[Problems]To provide a gene marker which enables diagnosis of rejection, evaluation of the efficacy of an immunosuppressive agent, and determination of the presence or absence of immunological tolerance; methods that can be performed in a quick, simple, and convenient manner by using a gene marker as an indicator for diagnosing rejection, evaluating the efficacy of an immunosuppressive agent, identifying an immunosuppressive agent, selecting an immunosuppressive agent, determining the dose of an immunosuppressive agent, and judging the presence or absence of immunological tolerance; and a kit.[Means for Solving Problems]Immune-related genes whose expression levels were increased by 1.5-fold or more because of rejection and whose expression levels were decreased by 1.5-fold or more because of immunosuppressive agents have been identified as gene markers. By using the expression level of one of these gene markers as an indicator, it becomes possible to diagnose rejection, evaluate the efficacy of an immunosuppressive agent, and judge the presence or absence of immunological tolerance in a quick, simple, and convenient manner.

The invention discloses an immunity-related biomarker and an application of the biomarker to prognosis diagnosis of head and neck squamous cell carcinoma. The biomarker comprises four immune-related genes PVR, TNFRSF12A, IL-21R and SOCS1, and the biomarker and Path_N jointly form a head and neck squamous cell carcinoma prediction prognosis model. A group of new high-sensitivity and specific immunity-related molecular markers are developed for HNSCC prediction prognosis diagnosis to improve the outcome of a patient, which meets the current urgent demands. A model detection method is simple andeasy to operate, helps to better identify HNSCC patients, and can be used as a guidance basis for HNSCC immunotherapy decisions.

The invention belongs to the technical field of medicines, and particularly relates to a method for screening immune infiltration related prognostic genes in a breast cancer tumor microenvironment. The method comprises the following steps of performing tumor immune related gene analysis on a TCGA-BRCA data set and 3 GEO transcriptome data sets subjected to batch correction through an estimate algorithm, and grouping obtained immune related gene score data according to high and low scores; performing differential expression analysis; taking an intersection of differential expression analysis results obtained by the TCGA-BRCA data set and the GEO transcriptome data sets; and performing single-factor cox regression analysis on the intersection result of the TCGA-BRCA data set and the GEO transcriptome data sets by combining clinical data, performing lasso regression analysis, performing multi-factor cox regression analysis, and finally, performing survival analysis to obtain the breast cancer immune infiltration related prognostic gene. The breast cancer immune infiltration prognosis related gene with high reliability screened based on the method can provide effective information fordiagnosis and treatment of breast cancer.

The invention discloses a grass-carp IFN-gamma 2 gene. The grass-carp IFN-gamma2 gene has a nucleotide sequence shown in a sequence table SEQ ID NO:1. The invention also discloses recombinant proteinfor expressing the grass-carp IFN-gamma 2 gene, and the recombinant protein has a nucleotide sequence shown in a sequence table SEQ ID NO:2. The recombinant protein can promote excitation of grass-carphead-kidneymacrophagein vitro, and expression of immune-related genes is up-regulated. The recombinant protein is injected to into grasscarp, the death rate that the grasscarpinfects flavobacteriumcolumnare can be remarkably reduced, the immune protective rate of the grasscarp is increased, the immunity index of the grasscarp can be adjusted, and the grass-carp capacity of resisting bacterial infection is enhanced.

The invention discloses an immunoadjuvant of an oral vaccine for tilapia and a use thereof. The immunoadjuvant of an oral vaccine for tilapia is a recombinant tilapia heat shock protein 70 (tHSP70). A tHSP70 gene is cloned by specific upstream and downstream primers of HSP70; a tHSP70 yeast expression system is constructed; and a tHSP70 protein is expressed and purified. Through combined utilization of the tHSP70 protein and an oral tilapia streptococcus vaccine, NO release and phagocytosis activity of macrophages of the tilapia enterocoelia are improved obviously; proliferation activity of peripheral blood lymphocytes is improved; the expression of immune-related genes is adjusted; and an immune protection rate of an oral tilapia streptococcus vaccine is improved. Through the use of the immunoadjuvant of an oral vaccine for tilapia, the defect of poor immune effects of the existing oral vaccine for tilapia is overcome and application of a vaccine in an aquaculture industry is promoted.

The invention discloses an application of a scoring system based on an immunogene pair in prediction of immunotherapy curative effect and prognosis of a non-small cell lung cancer patient. The scoring system disclosed by the invention is carried out based on the following four immune related gene pairs: CCL2 and VEGFA genes, CDK1 and CXCL9 genes, HLA-DOB and LCK genes, and IL-12A and TBX21 genes. The IRGP index (IRGPI) calculated based on an immune gene pair scoring system constructed by the invention is significantly related to the progression-free lifetime of a non-small cell lung cancer patient receiving anti-PD-1 immunotherapy. Therefore, the four immune-related gene pairs and the scoring system constructed according to the four immune-related gene pairs can be used for performing curative effect and prognosis prediction on the non-small cell lung cancer patient receiving anti-PD-1 immunotherapy.

The invention discloses application of a group of immune-related molecular markers in tissues identified based on a TCGA database in esophageal cancer prognosis. The application specifically comprises the following steps: establishing an immune gene prognosis model related to esophageal cancer prognosis; the method for establishing the model comprises the following steps: step 1, collecting and processing data; step 2, screening differentially expressed genes; and step 3, identifying differentially expressed immune related genes; step 4, performing transcription factor analysis and construction of a transcription factor immune differential expression gene regulation and control network; step 5, performing survival analysis; and step 6, establishing a prognosis risk index evaluation model based on esophageal cancer immune related genes.

The invention relates to a breast cancer prognosis model construction and application method and a storage medium, and the construction method comprises the steps: obtaining a breast cancer training data set, and carrying out the preprocessing of the data of each patient in the breast cancer training data set, and the data of each patient comprises a plurality of features; dividing the breast cancer training data set into different groups based on the plurality of features, the different groups being determined based on infiltration levels of different immune cells; differential expression genes between the different groups are analyzed, candidate genes are obtained through filtering, and the differential expression genes comprise the differential expression genes related to immune infiltration and the differential expression genes participating in a transfer mechanism; and constructing a risk scoring model based on the candidate genes. By integrating immune related gene signals related to metastasis, the prognosis effect of a patient can be evaluated more accurately, and treatment of the patient can be guided.

The invention discloses a renal cell carcinoma survival risk biomarker group, a diagnostic product and application, and particularly relates to biomarkers SLC11A1, TEK and THRB. Single factor Cox analysis finds that immune related genes SLC11A1, TEK and THRB are related to survival of renal cell carcinoma, a prediction model is constructed though LASSO Cox analysis, and it is found that the prediction model constructed by the above genes can independently predict prognosis of renal cell carcinoma.

The invention aims to provide a cynoglossus semilaevis disease-resistant immune related gene. In the cynoglossus semilaevis disease-resistant immune related gene, the amino acid sequence is SEQ ID NO:1, and the nucleotide sequence of the coding gene is SEQ ID NO:2. A cynoglossus semilaevis IgT gene is cloned for the first time, the cDNA sequence is obtained, the PCR primer of expression detectionis designed, and a method for detecting skin mucus, extracting total RNA in the mucus and detecting the expression of the IgT gene as well as a method of applying the expression level of the IgT genein the skin mucus as a disease resistance evaluation index are created, so that a molecular method for performing non-destructive detection on the disease resistance of the cynoglossus semilaevis is created and can be applied to cynoglossus semilaevis disease resistance test and disease-resistant fine seed breeding. The technical method can be popularized and applied to other fishes.

The invention relates to a loop-mediated isothermal amplification primer for detecting streptococcus agalactiae of tilapias. The primer is designed according to a conserved sequence of a surface immunogenic gene of the streptococcus agalactiae of the tilapias and comprises sip-F3, sip-B3, sip-FIP and sip-BIP respectively shown by SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4. A loop-mediated isothermal amplification method for detecting the streptococcus agalactiae of the tilapias can be established according to the designed primer. In the method, cross reactions with several common pathogenic bacteria of aquatic animals and several common pathogenic bacteria of streptococcus cannot happen. The detection method provided by the invention does not need expensive instruments, and is short in time, simple in operation and high in sensitivity.

Polymorphism detection probes that can distinguish polymorphisms that have only one different base are provided. At least one oligonucleotide selected from the group consisting of the oligonucleotides of SEQ ID NOS. 4, 23, 30, 47, 57 and 64 is used as a probe in a Tm analysis. A Tm analysis using such probes allows easy detection of specific polymorphisms of the FCGR3A gene, the FCGR2A gene, the IL-10 gene, the TNF α gene and the TNF 8 gene that have an effect on the pharmaceutical effects of antibody drugs or the like. Moreover, such probes allow detection of two or more types of polymorphisms in a single reaction system by introducing two or more types of the probes concomitantly.

The invention discloses a primary hepatocellular carcinoma molecular typing and survival risk gene group, a diagnosis product and application. The gene group comprises 62 molecular typing and survivalrisk assessment related genes and 6 reference genes, wherein the 62 molecular typing and survival risk assessment related genes consist of 18 cell proliferation related genes, 5 immunity related genes, 21 extracellular matrix related genes, 17 exosome related genes and 1 FTH family gene. The diagnosis product comprises a reagent used for detecting an expression level of the genes in the gene group. The primary hepatocellular carcinoma molecular typing and survival risk gene group and the diagnosis product have higher accuracy in primary hepatocellular carcinoma molecular typing and survival risk assessment by screening the specific gene group and detecting the expression level of the genes in the gene group.

The invention relates to the field of data mining in bioinformatics, in particular to a multi-source data fusion framework for revealing a breast cancer immune escape regulation mechanism. The framework is implemented mainly according to the following steps of: (1) collecting related data of breast cancer samples and normal samples; (2) clustering the breast cancer samples by using NMF (Non-negative Matrix Factorization) to obtain sample subgroup types; (3) comparing the breast cancer samples with the normal samples obtained from GTEx, and finding out differentially expressed related genes; (4) designing a regulation and control analysis algorithm based on ATAC-SEQ data to find immune related genes; (5) verifying the relationship between the TF and the immune gene by using five general databases; and (6) analyzing whether the immune gene obtained according to the framework affects the survival of the patient. The invention provides a multi-source data fusion framework for revealing a breast cancer immune escape regulation mechanism, and the framework has important significance for researching drug relocation and realizing precise medical treatment. The biological significance of the research process and the research result can be effectively improved. More importantly, the single-sample law analysis method can be used for deeply exploring the heterogeneity of a tumor, and has important significance on precise medical practice.

The invention belongs to the technical field of biology, and concretely discloses a mandarin fish gamma interferon relevant factor as well as a recombinant protein and application thereof. By designing merging primer amplification to obtain an IFN-gammarel gene fragment, the amplification is performed by a race method to obtain a complete gene sequence; IFN-gammarel-ORF-F and IFN-gammarel-ORF-R are used as primers; mandarin fish head kidney intestine mixed tissue total RNA is used as a template to perform amplification so as to obtain a complete open reading frame of the IFN-gammarel gene; thenucleotide sequence is shown as SEQ ID NO.1; the corresponding coding amino acid sequence is shown as SEQ ID NO.2. Through primary verification, the IFN-gammarel recombinant protein can induce the up-regulated expression of immune related genes Mx, IRF1, STAT1 and SOCS1, and can be used as fish immunopotentiators or immunologic adjuvants.

Oreochromis niloticus alexin C9 gene clone and application thereof. The invention belongs to functional study of the Oreochromis niloticus infected Streptococcus agalactiae. The invention discloses immune-related gene OnC9 of Oreochromis niloticus, and the nucleotide sequence is shown in the table SEQ ID NO.1. And the invention discloses the sequence of the immune-related protein OnC9 of Oreochromis niloticus, and the amino acid sequence thereof is shown in the sequence table SEQ ID NO.2. The method uses the disclosed nucleotide sequence of Oreochromis niloticus OnC9 to design a primer of fluorogenic quantitative PCR detection (C9-qf:5'-GGCTTGAAGTCGCTCTCCA-3'; C9-qr:5'-GCCAAATGCTTCTACACTTCG-3'), and carries out the fluorogenic quantitative PCR detection for the healthy Oreochromis niloticus or Oreochromis niloticus infected Streptococcus agalactiae. The method can be used for researching immune response of Oreochromis niloticus after infecting Streptococcus agalactiae.

The invention provides an application of an immune-related gene in a kit and a system for predicting the prognosis of a colorectal cancer. A group of characteristic genes capable of stably predictingthe prognosis of the colorectal cancer is found by combining the immune-related gene; on the premise that a standardized technology platform is not adopted to uniformly measure, any type of measurement platform can be compatible to predict the prognosis of the colorectal cancer; by adopting the system, the prognosis of colorectal cancer can be well predicted and the risk of early colorectal cancerpatients can be remarkably predicted. Univariate and multivariate analysis can also be carried out, and it is proved that the prognosis risk of colorectal cancer patients can be independently predicted by using an immune risk model (IRGS).

The invention discloses a method used for evaluating an immunomodulatory effect of lactobacillus acidophilus and an application of the method, and belongs to the field of biotechnology. According to the method provided by the invention, a dynamic change situation of immunity-related differentially expressed genes is detected, wherein the differentially expressed genes include up-regulated immunity-related genes CCL2, CCL20, IL1 alpha, IL1 beta, IL6ST, IL8, PTX3 and TNFRSF9 and a down-regulated immunity-related gene CXCR4. Through the method, the immunomodulatory effect of the lactobacillus acidophilus can be evaluated only by detecting nine immunity-related genes, and quick detection can be realized by utilizing Real Time PCR, so that the time is greatly shortened and the deficiency of existing evaluation of the immunomodulatory effect of the lactobacillus acidophilus is overcome; and the method is well verified in a mouse test and a Caco-2 cell.

The invention relates to a liver cancer prognosis evaluation gene set. Specifically, a gene set composed of 62 specific immune related genes is used for predicting and evaluating prognosis of a liver cancer patient, and a scientific basis is provided for medical decision making. The invention further relates to a kit for predicting liver cancer prognosis, computing equipment and a storage medium.

The invention discloses a preparation method and application of aeromonas multivalent DNA (Deoxyribonucleic Acid) vaccine and belongs to the technical field of prevention and control of diseases of aquatic animals. The technical scheme provided by the invention is characterized in that a specific primer for amplifying an aeromonas hydrophila major adhesion gene is designed and a primer sequence ismah-F: 5'CGCGGATCCATGAAAAAGACAATTCTGGC3'; mah-R: 5'CCCAAGCTTTTAGAAGTTGTATTGCAGGG3'; underlines are enzyme cutting sites; bacteria are cultured and aeromonas hydrophila DNA is extracted; an aeromonashydrophila major adhesion gene segment is amplified; a pcDNA3.1 plasmid is used as a carrier to construct a recombinant plasmid and the recombinant plasmid is sequenced and identified and is named asa mah-pcDNA3.1 recombinant plasmid, i.e., the aeromonas multivalent DNA vaccine. According to the DNA vaccine disclosed by the invention, a recombinant vaccine containing mah genes is immunized and inoculated into cultured fishes, major adhesion protein is generated in fish bodies and expression of anti-infection immune related genes is regulated and controlled, so that various types of infectioncaused by aeromonas are effectively prevented and controlled.

The invention provides application of immune-related genes in a kit and a system for predicting prognosis of diffuse glioma. According to the application, a group of characteristic genes capable of stably predicting prognosis of diffuse glioma are found by combining the immune-related genes; the prognosis of diffuse glioma can be well predicted by adopting the system; and single-factor and multi-factor Cox proportional risk regression analysis is carried out, and the immune risk score is proved to be really capable of being used as an independent prognosis factor of diffuse glioma.

The invention discloses a crucian herpesvirus disease JDORF25 vaccine as well as a preparation method and an application thereof. The crucian herpesvirus disease vaccine is recombinant protein truncated, optimized and translated by crucian herpesvirus type II immuno-related ORF25 gene, wherein the sequence is shown in SEQ ID NO.2; the gene segment is synthesized, transferred to a yeast expression vector and screened by highly copying and cloning to finally obtain a high-expression recombinant protein pichia pastoris Km71 / CyHV-2-25 Pichia pastoris Km71 / CyHV-2-25, CCTCC NO: M2014570. The protein fermented by the yeast has the characteristics of high activity and high yield. The passive immunity test defines that the antigen protein can effectively prevent crucian herpesvirus disease and can also be mixed with adjuvants for highly effectively preventing crucian herpesvirus disease.

The invention discloses a biomarker for predicting prognosis of a kidney cancer patient. The biomarker comprises immune related genes PLAUR, PLTP, RNASE2 and RORA, and prediction of the lifetime of the kidney cancer patient can be realized by detecting the expression level of the biomarker.

The invention belongs to the technical field of biologics and discloses a method for establishing NOD-Rag2nullIL-2Rgamma null immune deficiency mice by using a gene edition technique. The method comprises the following steps: (1) knocking off genes Rag2 and IL-2Rgamma in a mouse embryo genome by using a CAS9 technique so as to delete immune systems of mice, and establishing DNA (Deoxyribonucleic Acid) without immune related gene functions of mouse embryos; (2) purifying the DNA established in the step (1), and carrying out in vitro transcription with SP6 reverse transcriptase so as to obtain mRNA; (3) purifying the mRNA obtained in the step (2), and cryopreserving in ultrapure water without an RNA enzyme for later micro-injection; and (4) under an SPF grade breeding condition, breeding fertilized female mice and pseudopregnancy female mice. By using the latest CAS9 gene edition technique, specific knockoff of the genes Rag2 and IL-2Rgamma is carried out, immune deficiency of T, B and NK is achieved, blanks of strains of different gene edition types are made up, and requirements of animal testing and disease model research can be met.