Preparation method and application of aeromonas multivalent DNA (Deoxyribonucleic Acid) vaccine
A DNA vaccine, Aeromonas technology, which is applied in the field of preparation of Aeromonas multivalent DNA vaccine, can solve the problem of no adhesin nucleic acid vaccine, etc., achieves safe and efficient immune protection effect, prevents infection, and has a good development trend Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Construction method of recombinant plasmid of Aeromonas hydrophila gene mah-pcDNA3.1
[0041] Step S1: Extraction of Aeromonas hydrophila Genomic DNA
[0042] Aeromonas hydrophila was isolated from fish suffering from bacterial enteritis in our laboratory. The bacteria were cultured in brain heart infusion broth, and the bacterial genomic DNA was purified with a conventional DNA extraction kit;
[0043] Step S2: Design of specific primers for the major adhesin gene of Aeromonas hydrophila
[0044] Specific primers designed to amplify the major adhesin gene mah of Aeromonas hydrophila, the primer sequence is mah-F: 5'CGC GGATCC ATGAAAAAGACAATTCTGGC 3'; mah-R: 5' CCC AAGCTT TTAGAAGTTGTATTGCAGGG3', the underline is the restriction site;
[0045] Step S3: PCR amplification of the genomic DNA of Aeromonas hydrophila
[0046] Take 1 μL of Aeromonas hydrophila genomic DNA as a template, 1 μL of upstream and downstream primers of the target gene, 2.5 μL of dNTP, 2.5 μL of ...
Embodiment 2
[0054] Evaluation of immune protective effect of mah-pcDNA3.1 DNA vaccine on carp
[0055] Immunization of Yellow River carp with DNA vaccine: Healthy Yellow River carps (50±10 g) were randomly divided into six groups, 30 fish in each group. Each fish was immunized with mah-pcDNA3.1 recombinant plasmid by intramuscular injection of dorsal fin at a dose of 10 μg (dissolved in 50 μL of ultrapure water), and pcDNA3.1 was empty as a control group. The vaccinated fish were kept in a constant temperature water tank at 25°C for 28 days.
[0056] Detection of Mah protein in fish: Take one fish muscle tissue to extract protein on the 1st, 7th, 14th, 21st, and 28th days after injection. 20 mg of muscle tissue was lysed by adding RIPA lysate, and then 100 μg of the lysed total protein was subjected to SDS-PAGE electrophoresis, electrotransformed onto PVDF membrane, and detected by Western blot with the primary antibody of Mah protein and the commercialized secondary antibody. The resul...
Embodiment 3
[0062] mah-pcDNA3.1 DNA vaccine regulates the expression of immune genes in fish
[0063] RNA extraction and reverse transcription: 28 days after mah-pcDNA3.1 DNA vaccine immunization, the liver tissues of 3 fish in each group were collected for RNA extraction. Total RNA was extracted according to the Trizol method, added with DNase I, digested at 37°C for 1 h to remove genomic DNA contamination, and then reverse-transcribed with random primers, and quantitatively detected by fluorescence using the reverse-transcribed product as a template.
[0064] qRT-PCR detection of expression of immune-related genes in fish: Fluorescent quantitative RT-PCR method was used to detect the expression levels of five genes including IgM, TNFα, c-type lysozyme, g-type lysozyme and IL-1β, and the expression levels of 5 genes were measured by β The -actin gene was used as an internal reference. The specific primers are: IgM-F: 5'GCGCGTGAGGAAAAGTGATT 3', IgM-R: 5'GAAAACCGCTGGGCTAAACA 3'; TNFα-F: 5...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com