Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method and application of aeromonas multivalent DNA (Deoxyribonucleic Acid) vaccine

A DNA vaccine, Aeromonas technology, which is applied in the field of preparation of Aeromonas multivalent DNA vaccine, can solve the problem of no adhesin nucleic acid vaccine, etc., achieves safe and efficient immune protection effect, prevents infection, and has a good development trend Effect

Pending Publication Date: 2019-04-05
HENAN NORMAL UNIV
View PDF10 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, no adhesin nucleic acid vaccine has been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of aeromonas multivalent DNA (Deoxyribonucleic Acid) vaccine
  • Preparation method and application of aeromonas multivalent DNA (Deoxyribonucleic Acid) vaccine
  • Preparation method and application of aeromonas multivalent DNA (Deoxyribonucleic Acid) vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Construction method of recombinant plasmid of Aeromonas hydrophila gene mah-pcDNA3.1

[0041] Step S1: Extraction of Aeromonas hydrophila Genomic DNA

[0042] Aeromonas hydrophila was isolated from fish suffering from bacterial enteritis in our laboratory. The bacteria were cultured in brain heart infusion broth, and the bacterial genomic DNA was purified with a conventional DNA extraction kit;

[0043] Step S2: Design of specific primers for the major adhesin gene of Aeromonas hydrophila

[0044] Specific primers designed to amplify the major adhesin gene mah of Aeromonas hydrophila, the primer sequence is mah-F: 5'CGC GGATCC ATGAAAAAGACAATTCTGGC 3'; mah-R: 5' CCC AAGCTT TTAGAAGTTGTATTGCAGGG3', the underline is the restriction site;

[0045] Step S3: PCR amplification of the genomic DNA of Aeromonas hydrophila

[0046] Take 1 μL of Aeromonas hydrophila genomic DNA as a template, 1 μL of upstream and downstream primers of the target gene, 2.5 μL of dNTP, 2.5 μL of ...

Embodiment 2

[0054] Evaluation of immune protective effect of mah-pcDNA3.1 DNA vaccine on carp

[0055] Immunization of Yellow River carp with DNA vaccine: Healthy Yellow River carps (50±10 g) were randomly divided into six groups, 30 fish in each group. Each fish was immunized with mah-pcDNA3.1 recombinant plasmid by intramuscular injection of dorsal fin at a dose of 10 μg (dissolved in 50 μL of ultrapure water), and pcDNA3.1 was empty as a control group. The vaccinated fish were kept in a constant temperature water tank at 25°C for 28 days.

[0056] Detection of Mah protein in fish: Take one fish muscle tissue to extract protein on the 1st, 7th, 14th, 21st, and 28th days after injection. 20 mg of muscle tissue was lysed by adding RIPA lysate, and then 100 μg of the lysed total protein was subjected to SDS-PAGE electrophoresis, electrotransformed onto PVDF membrane, and detected by Western blot with the primary antibody of Mah protein and the commercialized secondary antibody. The resul...

Embodiment 3

[0062] mah-pcDNA3.1 DNA vaccine regulates the expression of immune genes in fish

[0063] RNA extraction and reverse transcription: 28 days after mah-pcDNA3.1 DNA vaccine immunization, the liver tissues of 3 fish in each group were collected for RNA extraction. Total RNA was extracted according to the Trizol method, added with DNase I, digested at 37°C for 1 h to remove genomic DNA contamination, and then reverse-transcribed with random primers, and quantitatively detected by fluorescence using the reverse-transcribed product as a template.

[0064] qRT-PCR detection of expression of immune-related genes in fish: Fluorescent quantitative RT-PCR method was used to detect the expression levels of five genes including IgM, TNFα, c-type lysozyme, g-type lysozyme and IL-1β, and the expression levels of 5 genes were measured by β The -actin gene was used as an internal reference. The specific primers are: IgM-F: 5'GCGCGTGAGGAAAAGTGATT 3', IgM-R: 5'GAAAACCGCTGGGCTAAACA 3'; TNFα-F: 5...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method and application of aeromonas multivalent DNA (Deoxyribonucleic Acid) vaccine and belongs to the technical field of prevention and control of diseases of aquatic animals. The technical scheme provided by the invention is characterized in that a specific primer for amplifying an aeromonas hydrophila major adhesion gene is designed and a primer sequence ismah-F: 5'CGCGGATCCATGAAAAAGACAATTCTGGC3'; mah-R: 5'CCCAAGCTTTTAGAAGTTGTATTGCAGGG3'; underlines are enzyme cutting sites; bacteria are cultured and aeromonas hydrophila DNA is extracted; an aeromonashydrophila major adhesion gene segment is amplified; a pcDNA3.1 plasmid is used as a carrier to construct a recombinant plasmid and the recombinant plasmid is sequenced and identified and is named asa mah-pcDNA3.1 recombinant plasmid, i.e., the aeromonas multivalent DNA vaccine. According to the DNA vaccine disclosed by the invention, a recombinant vaccine containing mah genes is immunized and inoculated into cultured fishes, major adhesion protein is generated in fish bodies and expression of anti-infection immune related genes is regulated and controlled, so that various types of infectioncaused by aeromonas are effectively prevented and controlled.

Description

technical field [0001] The invention belongs to the technical field of aquatic animal disease prevention and control, and in particular relates to a preparation method and application of an Aeromonas multivalent DNA vaccine. Background technique [0002] Aeromonas is a large class of pathogenic diseases that widely exist in various freshwater aquaculture water bodies. It can cause a variety of aquatic animals to become ill, cause hemorrhagic disease in aquatic animals, and cause serious economic losses to the aquaculture industry. The main pathogen of fulminant infectious diseases in farmed fish. In addition, Aeromonas not only infects freshwater fish, but is also a pathogenic microorganism shared by humans, animals and fish. It can cause local infection or systemic sepsis in animals, and even acute gastroenteritis, sepsis, wound infection, and otitis media in humans. , peritonitis, etc. With the continuous increase of people's consumption of aquatic products, its status a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/116A61K39/02A61P31/04C12N15/85C12N15/31
CPCA61K39/0208A61K2039/70A61P31/04C07K14/28C12N15/85C12N2800/106
Inventor 赵贤亮孔祥会裴超李莉靳朝晖
Owner HENAN NORMAL UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More