Check patentability & draft patents in minutes with Patsnap Eureka AI!

A recombinant Escherichia coli expressing fusion protein of formamidase and phosphorous acid dehydrogenase and its construction method and application

A technology of phosphite dehydrogenase and recombinant Escherichia coli, applied in the field of genetic engineering, can solve problems such as common contamination, achieve the effects of high material purity, solve the problem of contamination, and reduce the demand for fermentation equipment

Active Publication Date: 2021-07-20
SOUTH CHINA UNIV OF TECH
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the complex surrounding environment and the hidden parts of the fermentation equipment make it often contaminated with bacteria during the fermentation process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A recombinant Escherichia coli expressing fusion protein of formamidase and phosphorous acid dehydrogenase and its construction method and application
  • A recombinant Escherichia coli expressing fusion protein of formamidase and phosphorous acid dehydrogenase and its construction method and application
  • A recombinant Escherichia coli expressing fusion protein of formamidase and phosphorous acid dehydrogenase and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Acquisition of formamidase gene for (including Linker sequence)

[0052] Cultivate Paenibacillus pasadenensis.CS0611 with LB medium for one day at 37°C and 180rpm; collect the cultured cells by centrifuging at 4°C and 8000rpm for 5 minutes, and wash them twice with normal saline to remove residual culture base, and then extract the Paenibacillus paenibacillus pasadenensis.CS0611 genome according to the specific method of the OMEGA bacterial genome DNA extraction kit;

[0053] Take the extracted Paenibacillus pasadenensis.CS0611 genome as a template, with and A2 (5'- CGACCCACC ACCGCCCGAGCCACCGCCACC TCGCGCCGCGCCTCCCTTCG C-3') are the upstream and downstream primers respectively, and the formamidase gene for-Linker is amplified by PCR;

[0054] The enzyme reagent used in PCR is TaKaRa company's HS DNA Polymerase with GCbuffer; PCR reaction system and conditions are as follows:

[0055] Composition of PCR reaction solution (25μL)

[0056]

[0057] PCR reactio...

Embodiment 2

[0060] Acquisition of phosphite dehydrogenase gene ptx

[0061] The phosphite dehydrogenase gene is derived from Klebsiella pneumonia.OU7, which was independently screened, and was obtained through independent screening;

[0062] According to the specific method of OMEGA Bacterial Genomic DNA Extraction Kit, the genome of Klebsiella pneumonia. - TGGCTCGGGCGGTGGTGGGTCGATGCTGCCGAAACTCGTTATA-3') and The upstream and downstream primers are used to amplify the phosphite dehydrogenase gene ptx by PCR;

[0063] The enzyme reagent used in PCR is TaKaRa company's HS DNA Polymerase with GCbuffer; PCR reaction system and conditions are as follows:

[0064] Composition of PCR reaction solution (25μL)

[0065]

[0066]

[0067] PCR reaction conditions: react at 94°C for 5min; then react at 98°C for 10s, 55°C for 5s, and 72°C for 70s, and cycle 30 times; then react at 72°C for 7min; finally cool down to 16°C.

[0068] The DNA product obtained by PCR amplification was electrop...

Embodiment 3

[0070] The fusion gene for-Linker-ptx was obtained by overlapping PCR amplification

[0071] Use the amplified for-Linker and ptx fragments as templates and primers and primers The upstream and downstream primers are respectively used to amplify the fusion gene for-Linker-ptx.

[0072] The amplification conditions are as follows: react at 94°C for 5 min; then react at 98°C for 10 s, 55°C for 5 s, and 72°C for 150 s, and cycle 30 times; finally react at 72°C for 7 min; finally cool down to 16°C.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an Escherichia coli expressing fusion protein of formamidase and phosphorous acid dehydrogenase, its construction method and application. The present invention takes Escherichia coli DH5α engineering bacteria as the host, amplifies the cloned formamidase gene and phosphorous acid dehydrogenase gene into a fusion gene, then connects it to the multi-cloning site of the carrier, and transforms the obtained recombinant plasmid into DH5α, the plasmid was extracted and transformed into an expression strain, and recombinant Escherichia coli was obtained through induction culture. The recombinant Escherichia coli expresses and produces a fusion protein of formamidase and oxidized phosphorous acid dehydrogenase, which can simultaneously decompose formamide to generate NH 4 + and oxidized phosphite phosphate to become phosphate, providing the nitrogen source and phosphorus source needed for growth and reproduction of recombinant E. It grows and reproduces in MOPS medium, which solves the problem of Escherichia coli contamination in industrial fermentation.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a recombinant Escherichia coli expressing a fusion protein of formamidase and phosphorous acid dehydrogenase and its construction method and application. Background technique [0002] Escherichia coli is currently one of the most widely used hosts, because the Escherichia coli genome has been thoroughly studied, and it reproduces quickly and has a short fermentation cycle. Therefore, Escherichia coli is closely watched and valued by entrepreneurs in the industrial fermentation industry. However, in the process of E. coli fermentation, the problem of bacterial contamination is still the most concerned issue of enterprises. Once contaminated, it will not only cause economic loss, waste of principles and time, but also increase the difficulty of waste disposal. Therefore, if a method can be found to solve the problem of E. coli being contaminated by miscellaneous bacteria during...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12N15/70C12N15/62C12N15/66C12N9/80C12N9/02C12R1/19
CPCC12N9/0004C12N9/80C12N15/66C12N15/70C12Y120/01001C12Y305/01049C12Q1/686
Inventor 娄文勇区晓阳宗敏华高嘉心彭飞徐培
Owner SOUTH CHINA UNIV OF TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com