Unlock instant, AI-driven research and patent intelligence for your innovation.

VZV glycoprotein E gene expression vector as well as recombinant yeast strain and application thereof

A technology of gene expression and expression vector, applied in the field of genetic engineering

Pending Publication Date: 2018-07-24
BRAVOVAX
View PDF14 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the characteristics of the glycoprotein E gene of varicella-zoster virus and the insufficiency of other expression systems, expressing the glycoprotein E gene of varicella-zoster virus with Pichia pastoris expression system can be used as a possible choice and way, but There have been no reports and studies on the successful expression of the varicella-zoster virus glycoprotein E gene in the Pichia pastoris expression system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • VZV glycoprotein E gene expression vector as well as recombinant yeast strain and application thereof
  • VZV glycoprotein E gene expression vector as well as recombinant yeast strain and application thereof
  • VZV glycoprotein E gene expression vector as well as recombinant yeast strain and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0082] Preparation and construction method of embodiment 1 recombinant vector

[0083] 1. Synthesis of VZV gE gene sequence

[0084] According to the yeast codon preference, the original sequence of gE was codon-optimized without changing the amino acid sequence to obtain the gene nucleotide sequence SEQ ID NO.1.

[0085] SEQ ID NO.1:

[0086] ATGGGGACAGTTAATAAACCTGTGGTGGGGGTATTGATGGGGTTCGGAATTATCACGGGAACGTTGCGTATAACGAATCCGGTCAGAGCATCCGTCTTGCGATACGATGATTTTCACATCGATGAAGACAAACTGGATACAAACTCCGTATATGAGCCTTACTACCATTCAGATCATGCGGAGTCTTCATGGGTAAATCGGGGAGAGTCTTCGCGAAAAGCGTACGATCATAACTCACCTTATATATGGCCACGTAATGATTATGATGGATTTTTAGAGAACGCACACGAACACCATGGGGTGTATAATCAGGGCCGTGGTATCGATAGCGGGGAACGGTTAATGCAACCCACACAAATGTCTGCACAGGAGGATCTTGGGGACGATACGGGCATCCACGTTATCCCTACGTTAAACGGCGATGACAGACATAAAATTGTAAATGTGGACCAACGTCAATACGGTGACGTGTTTAAAGGAGATCTTAATCCAAAACCCCAAGGCCAAAGACTCATTGAGGTGTCAGTGGAAGAAAATCACCCGTTTACTTTACGCGCACCGATTCAGCGGATTTATGGAGTCCGGTACACCGAGACTTGGAGCTTTTTGCCGTCATTAACCTGTACGGGAGACGCAGCGCCCGCC...

Embodiment 2

[0103] Example 2 Preparation of recombinant yeast strain and its expression detection

[0104] 1. Transformation of recombinant plasmid pHC-gE yeast strain

[0105] The recombinant plasmid pHC-gE obtained in Example 1 was introduced into Escherichia coli DH5α for massive amplification, and then the plasmid was extracted. Take an appropriate amount of recombinant plasmid pHC-gE, and use the restriction endonuclease AflⅡ to carry out linearization single enzyme digestion, and agarose gel electrophoresis to detect that the restriction endonuclease linearization is complete, and the enzyme-cut vector is recovered from the solution. Fresh Pichia pinkTM S1 yeast competent cells were prepared, and the linearized vector was electrotransformed into Pichia pinkTM S1 yeast competent cells. The electroporation conditions were: 2000V, 25μF, 400Ω, electroporation for 5ms. After the electric shock, 1 mL of pre-cooled 1M sorbitol solution was quickly added, and after mixing, the bacterial so...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a VZV (varicella-zoster virus)glycoprotein E gene eukaryotic expression vector as well as a recombinant yeast strain and application thereof. The vector is a connector of alpha-gE fused gene and pPink-HC, and the alpha-gE fused gene is a gene complete sequence of VZV glycoprotein E and a fused gene alpha signal peptide. The glycoprotein E capable of successfully expressingthe VZV in an expression system of pichia pastoris discloses by the invention sets the foundation for the detection of the protein immunogenicity as well as the efficient expression of the protein inthe pichia pastoris as well as the research of the VZV vaccine.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to an expression vector capable of expressing VZV (varicella-zoster virus) glycoprotein E gene, its recombinant yeast and its application. Background technique [0002] Varicella-zoster virus (VZV) is a member of the α-herpesvirus subfamily of the genus Herpesviridae. It is a DNA virus with a diameter of 150-200 nm. Morphologically, it is composed of a nucleic acid core and a protein capsid. A concentric circular structure composed of an envelope, and a symmetrical icosahedron composed of 162 shell particles on the surface. It has the characteristics of tropism for the skin and nerves. It is a double-stranded DNA virus that frequently occurs in young children and the elderly. It is a A fast-onset, highly contagious disease. It can cause chickenpox and herpes zoster, two common diseases, and can also cause serious complications such as encephalitis and pneumonia; after the patient...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12N15/66C12N15/62C12N1/19C12P21/02C12R1/84
CPCC07K14/005C07K2319/02C12N15/62C12N15/66C12N15/815C12N2710/16722
Inventor 肖杨王雨高媛刘昊智毛普加幕婷李津吴克
Owner BRAVOVAX
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More