VZV glycoprotein E gene expression vector as well as recombinant yeast strain and application thereof
A technology of gene expression and expression vector, applied in the field of genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0082] Preparation and construction method of embodiment 1 recombinant vector
[0083] 1. Synthesis of VZV gE gene sequence
[0084] According to the yeast codon preference, the original sequence of gE was codon-optimized without changing the amino acid sequence to obtain the gene nucleotide sequence SEQ ID NO.1.
[0085] SEQ ID NO.1:
[0086] ATGGGGACAGTTAATAAACCTGTGGTGGGGGTATTGATGGGGTTCGGAATTATCACGGGAACGTTGCGTATAACGAATCCGGTCAGAGCATCCGTCTTGCGATACGATGATTTTCACATCGATGAAGACAAACTGGATACAAACTCCGTATATGAGCCTTACTACCATTCAGATCATGCGGAGTCTTCATGGGTAAATCGGGGAGAGTCTTCGCGAAAAGCGTACGATCATAACTCACCTTATATATGGCCACGTAATGATTATGATGGATTTTTAGAGAACGCACACGAACACCATGGGGTGTATAATCAGGGCCGTGGTATCGATAGCGGGGAACGGTTAATGCAACCCACACAAATGTCTGCACAGGAGGATCTTGGGGACGATACGGGCATCCACGTTATCCCTACGTTAAACGGCGATGACAGACATAAAATTGTAAATGTGGACCAACGTCAATACGGTGACGTGTTTAAAGGAGATCTTAATCCAAAACCCCAAGGCCAAAGACTCATTGAGGTGTCAGTGGAAGAAAATCACCCGTTTACTTTACGCGCACCGATTCAGCGGATTTATGGAGTCCGGTACACCGAGACTTGGAGCTTTTTGCCGTCATTAACCTGTACGGGAGACGCAGCGCCCGCC...
Embodiment 2
[0103] Example 2 Preparation of recombinant yeast strain and its expression detection
[0104] 1. Transformation of recombinant plasmid pHC-gE yeast strain
[0105] The recombinant plasmid pHC-gE obtained in Example 1 was introduced into Escherichia coli DH5α for massive amplification, and then the plasmid was extracted. Take an appropriate amount of recombinant plasmid pHC-gE, and use the restriction endonuclease AflⅡ to carry out linearization single enzyme digestion, and agarose gel electrophoresis to detect that the restriction endonuclease linearization is complete, and the enzyme-cut vector is recovered from the solution. Fresh Pichia pinkTM S1 yeast competent cells were prepared, and the linearized vector was electrotransformed into Pichia pinkTM S1 yeast competent cells. The electroporation conditions were: 2000V, 25μF, 400Ω, electroporation for 5ms. After the electric shock, 1 mL of pre-cooled 1M sorbitol solution was quickly added, and after mixing, the bacterial so...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


