InDel molecular marker closely linked with flowering time of photoperiod-sensitive Chinese cabbage crop and application thereof

A molecular marker, flowering time technology, applied in the field of genetic engineering and molecular biology, can solve the problems affecting plant phenotype, photoperiod sensitivity differences, etc., and achieve the goal of speeding up the breeding process, stabilizing variation, and improving screening efficiency and accuracy. Effect

Active Publication Date: 2018-09-07
NANJING AGRICULTURAL UNIVERSITY
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, there are many kinds of cabbage crops, and there are differences in sensitivity to photoperiod. The comparison of cloned sequences and the development of markers only in Chinese cabbage or only in turnip have certain limitations, and it is generally believed that the variation in exons is more than that in introns. Variations in introns are more likely to affect plant phenotypes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • InDel molecular marker closely linked with flowering time of photoperiod-sensitive Chinese cabbage crop and application thereof
  • InDel molecular marker closely linked with flowering time of photoperiod-sensitive Chinese cabbage crop and application thereof
  • InDel molecular marker closely linked with flowering time of photoperiod-sensitive Chinese cabbage crop and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1 determines photoperiod sensitive material

[0042] On August 3, 2017, 20 seeds of the parent material were germinated in a petri dish covered with filter paper, and then sowed in a plug tray after 36 hours of dark cultivation at 25°C. Sunlight (light 8h / darkness 16h), temperature 22°C / 18°C, relative humidity 70%, light intensity 72μmol·m-2·s-1 grow in a light incubator, and plant pots (17cM) after one month. At the same time, the F 2 The 180 strains of the generation segregation population were also sown in the hole trays, and after 3 weeks of growth in plastic greenhouses, they were planted in plastic greenhouses in Jurong Agricultural Expo Park, Nanjing Agricultural University from August 24, 2017 to December 26, 2017. Individual plants are numbered sequentially and managed in the normal field. Observing the parent and F 2 The flowering time of the generation segregation population, the flowering time investigation standard is the time (number of days)...

Embodiment 2

[0045] Embodiment 2 determines candidate markers

[0046] RNA Simple Total RNA Kit (TaKaRa) was used to extract the total RNA of the two parents. For specific methods, refer to the kit instructions. cDNA using PrimeScript TM II 1st Strand cDNA Synthesis Kit (TaKaRa) was synthesized by reverse transcription and used as a template for gene cloning.

[0047] CCA1 gene sequence refers to the published Chinese cabbage genome sequence (http: / / brassicadb.org / brad / :Bra004503; NCBI accession number: LOC103866427), using the online software Primer 3 (http: / / bioinfo.ut.ee / primer3- 0.4.0 / ) design the PCR primers for specific amplification of CCA1 gene,

[0048] CCA1-F: ATGGAGACTAATTCGTCTGGAG (SEQ ID NO. 7),

[0049] CCA1-R: TCATGTTGAAGTTTGTGTTTCC (SEQ ID NO. 8)

[0050] And synthesized by Nanjing Qingke Company.

[0051] The total volume of the PCR amplification system is 40 μL: 2 μL each of forward and reverse primers, 1 μL of template cDNA, 20 μL of high-fidelity enzyme MIX, and 15...

Embodiment 3

[0056] Embodiment 3 candidate mark and F 2 Correlation analysis and identification of flowering time in generation population

[0057] Extract F 2 The DNA of 24 leaves of the very early and very late flowering plants of the generation population, the specific method refers to the Axygen Plant Genomic DNA Extraction Kit.

[0058] Design specific primers pF1, pR1; pF2, pR2; pF3, pR3 (Table 1) for the 4 candidate markers (InDels) of the CCA1 coding region identified in the parents;

[0059] DNA from extremely early-flowering plants and DNA from extremely late-flowering plants were divided into 4 groups, a total of 8 groups, which were used as templates required for gene cloning of each differential site for PCR amplification. Here, 4 candidate markers and each group used The primers are:

[0060] Primer sequences used in the test in Table 1

[0061]

[0062] The total volume of the PCR amplification system in each group is 40 μL: 2 μL each of forward and reverse primers, 1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

According to the invention, early-flowering oil-used type variety 'YS-143' and late-flowering turnip variety 'VT-044' are taken as test materials, and the flowering time of the two in two conditions,namely long sunlight and short sunlight, are respectively observed. The cDNA sequence of the gene is cloned by taking two materials as a template simultaneously, and the amino acid sequence of the gene is analyzed by using a bioinformatics technology, so as to find the difference loci of the CCA1 genes of the early-flowering and late-flowering Chinese cabbage crops, and the difference loci is primarily confirmed by analysis such as bioinformatics and sequencing comparison, and then an InDel maker is developed. The nucleotide sequence of the InDel maker is ACCCTT, which is located on the sixthexon of the CCA1 gene of the early-flowering Chinese cabbage crop, but does not exist on the CCA1 gene coding region of the late-flowering Chinese cabbage crop. Finally, by verification, the InDel maker is taken as a functional marker for molecule assistant breeding operation. The molecular marker disclosed by the invention can be simply, conveniently and rapidly applied to breeding practice withhigh throughput.

Description

technical field [0001] The invention belongs to the fields of genetic engineering and molecular biology, and in particular relates to an InDel molecular marker closely linked with the flowering time of photoperiod-sensitive cabbage crops and its application. Background technique [0002] Cabbage crops (Brassica rapa) belong to the genus Brassica (Brassica) of the Cruciferae (Cruciferae). , cabbage-type rape and other types [1]. Oily cabbage crops include spring and winter European ecological types, Chinese cabbage-type rapeseed and Indian Sarson type, and the turnip type mainly characterized by rhizome enlargement is a relatively primitive cabbage crop cultivar[2]. Cabbage crops are divided into annual and biennial in flowering habits, and there are great differences in bolting and flowering time. Therefore, cabbage crops are a good system for studying bolting, flowering variation, breeding and genetics research [3]. [0003] Flowering time is an important agronomic trait...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6895C12Q1/6869C12N15/11
CPCC12Q1/6869C12Q1/6895C12Q2600/13C12Q2600/156C12Q2531/113C12Q2539/113
Inventor肖栋刘东让侯喜林李英张昌伟刘同坤王建军胡春梅
OwnerNANJING AGRICULTURAL UNIVERSITY