Fluorescent ring-mediated isothermal amplification method based on molecular beacon

A technology of isothermal amplification and molecular beacon probes, applied in biochemical equipment and methods, measurement/testing of microorganisms, resistance to vector-borne diseases, etc., can solve the problem of unrecognizable, difficult to preserve, and unobvious color reaction of HNB and other problems, to achieve the effect of solving the problem of non-specific amplification, huge application value and commercial value

Inactive Publication Date: 2018-12-21
INST OF PLA FOR DISEASE CONTROL & PREVENTION
View PDF7 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in addition to the amplification products, SYBR Green I can bind to all double-stranded DNA and emit light, resulting in difficult interpretation of the results and high fluorescence background values
In addition, since SYBRGreen I needs to open the reaction tube before adding after the reaction, the reaction cannot be carried out in a closed system, resulting in aerosol pollution.
[0006] 3. Precipitation method: Magnesium pyrophosphate precipitates will be produced during the LAMP reaction process, and the amount produced is relatively large. After the reaction is completed, all the precipitates can be gathered together by centrifugation. The result can be judged by visual observation, but due to coke Magnesium phosphate has very good dispersibility in the solution system, and it can be redispersed into the reaction solution in an instant after centrifugal aggregation, which is easy to produce false negatives
[0007] 4. Hydroxynaphthol blue staining (HNB): Hydroxynaphthol blue staining is a metal ion indicator, which can 2+ Different colors show different colors, due to the precipitation of magnesium pyrophosphate in the LAMP reaction, a large amount of Mg will be consumed 2+ , so that the color of HNB will change, but HNB is not stable, it is not easy to save, it needs to be used now, and it is inconvenient to use. Another problem is that the color reaction of HNB is not obvious, and it is not easy to detect the color change. Although many researches people are using this method, but it has not been recognized by everyone
[0011] None of these indirect detection methods can directly determine the amplification product. If non-specific amplification occurs, it will not be recognized. This is also a big problem encountered by LAMP technology.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent ring-mediated isothermal amplification method based on molecular beacon
  • Fluorescent ring-mediated isothermal amplification method based on molecular beacon
  • Fluorescent ring-mediated isothermal amplification method based on molecular beacon

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Embodiment 1, design synthesis and detection method optimization of primer probe

[0071] 1. Primer design and synthesis

[0072] A set of primer combinations for identifying Vibrio cholerae was obtained through a large number of sequence analysis and alignment. The primer set includes front primer (HL-F3), back primer (HL-B3), front inner primer (HL-FIP), back inner primer (HL-BIP) and two accelerated primers (HL-LF, HL-LB) . The primer sequences are as follows (5'→3'):

[0073] HL-F3 (Sequence 1 of the Sequence Listing): CCTAAATGTAGCAAATTGATTTCCT;

[0074] HL-B3 (SEQ ID NO: 2 of the SEQUENCE LISTING): GTCATTAGGTACTACCGAGG;

[0075] HL-FIP (SEQ ID NO: 3 of the Sequence Listing): TCCTTTTTTGTAGGGCTATGTTGTTGTTTGTGTGATTTTTGTGTGC;

[0076] HL-BIP (SEQ ID NO: 4 of the Sequence Listing): ACCATTTGCCTAGCCGTACTACAATAAAGTCACCTTCTTGG;

[0077] HL-LF (SEQ ID NO: 5 of the SEQUENCE LISTING): TGTGTTGCGCGCACAGTA;

[0078] HL-LB (SEQ ID NO: 6 of the Sequence Listing): TGCAGCCCTAC...

Embodiment 2

[0113] Embodiment 2, specificity

[0114] The samples to be tested are: Bacillus cereus ATCC 14579 (Bacillus cereus), Pseudomonasaeruginosa ATCC 15692 (Pseudomonas aeruginosa), Enterococcusfaecium ATCC 6569 (Enterococcus faecium), Streptococcus dysgalactiae ATCC 27957 (Streptococcus dysgalactiae), Escherichia coli ATCC (2592 coli), Streptococcus uberis ATCC 9927 (Streptococcus uberis), StreptococcuspneumoniaATCC 49619 (Streptococcus pneumoniae), Salmonella enterica ATCC 14028 (Salmonella enterica), Yersiniaenterocolitica ATCC 9610 (Yersinia enterocolitica), Yersinia enterocolitica ATCC 9610 (colon Yersinia pneumoniae), Vibrio Parahemolyticus ATCC 17802 (Vibrio parahaemolyticus), Staphylococcus aureus ATCC 25923 (Staphylococcus aureus), Shigellaflexneri ATCC 12022 (Frexnerella), staphylococcus epidermidis ATCC 12228 (Epidermal Staphylococcus), Enterococcus faecalis ATCC 29212 (Enterococcus faecalis), and Vibrio cholera ATCC 11561 (Vibrio cholerae).

[0115] 1. Using the total ...

Embodiment 3

[0124] Embodiment 3, sensitivity

[0125] 1. Dilute the Vibrio cholerae positive plasmid 10 times with sterile water to obtain each dilution.

[0126] 2. Using the dilutions obtained in step 1 as templates, use the primer combination in step 1 of Example 1 to carry out LAMP reaction.

[0127] LAMP reaction system (25 μL): template 2 μL, Tris-HCl (pH=8.8) 20 mM, KCl 10 mM, (NH4) 2 SO 4 10mM, betaine 0.8M, MgSO 4 8mM, dNTP1.4mM, Tween200.25μL, Bst DNA polymerase 8U, primer HL-F35pmol, primer HL-B35pmol, primer HL-FIP 40pmol, primer HL-BIP 40pmol, primer HL-LF 20pmol, primer HL-LB 20pmol, Molecular Beacon Probe LBP 8 pmol.

[0128] LAMP reaction conditions: constant temperature reaction at 63°C for 60 minutes.

[0129] Due to the different dilutions used, the following different reaction systems are formed:

[0130] In reaction system L1, the initial content of plasmid DNA is: 20ng;

[0131] In reaction system L2, the initial content of plasmid DNA is: 2ng;

[0132] In re...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fluorescent ring-mediated isothermal amplification method based on a molecular beacon. The amplification method introduces a molecular beacon into the LAMP technology, wherein the fluorescent ring-mediated isothermal amplification method based on the molecular beacon is established and named as MB-LAMP, thereby realizing direct detection of amplified products, and fundamentally solving the problem of non-specific amplification of the LAMP method, great application value and commercial value are achieved.

Description

technical field [0001] The invention relates to a fluorescent ring-mediated isothermal amplification method based on a molecular beacon. Background technique [0002] Loop-mediated isothermal amplification technology is a new in vitro nucleic acid amplification detection technology established by Notomi in 2001. It uses 4-6 primers to identify 6-8 specific nucleic acid fragments. DNA polymerase has the function of strand displacement. With its help, the target gene can be amplified efficiently and specifically in a short period of time under constant temperature conditions. At the same time, a large amount of white magnesium pyrophosphate precipitates from the reaction. Using this feature, the experimenter can judge whether the result is negative or positive by observing the turbidity of the reaction system. Since the LAMP reaction is carried out under constant temperature conditions, a stable heat source (such as a water bath or a metal bath) can meet the requirements of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6844C12Q1/689C12Q1/04C12N15/11
CPCC12Q1/6844C12Q1/689C12Q2531/119C12Q2563/107Y02A50/30
Inventor黄留玉刘威黄思妺刘宁伟邹大阳董德荣杨展敖大贺小明
OwnerINST OF PLA FOR DISEASE CONTROL & PREVENTION