A kind of biosynthesis method of quercetin glycoside
A quercetin glycoside and biosynthesis technology, applied in the field of genetic engineering, to achieve good application prospects, increase conversion rate and product yield, and mild synthesis conditions
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0028] Example 1 Preparation of Glycosyltransferase Mutants
[0029] (1) Single mutation
[0030] Two mutants V371A derived from onion glycosyltransferase UGT73G1, the amino acid sequence formula of SEQ ID NO.2, F381Y, shown in the amino acid sequence formula of SEQ ID NO.3;
[0031] According to the gene sequence of glycosyltransferase UGT73G1, site-directed mutagenesis was performed, the DNA coding sequence was determined, and introduced into Escherichia coli for expression to obtain a single mutant glycosyltransferase. The single mutants V371A and F381Y were synthesized by GenScript Biotechnology Co., Ltd. Constructed onto the pet28a vector.
[0032] The primers for site-directed mutagenesis of V371A are:
[0033] Forward primer:
[0034] TAAGAAGGAGATATACATATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTG
[0035] Reverse primer:
[0036] GGTTTCTTTACCAGACTCGAGTCATTA GTGGTGGTGGTGGTGGTG TTTGTTGCGACGGTC
[0037] The primers for site-directed mutagenesis of F381Y are:
[0038]...
Embodiment 2
[0055] Example 2 Fermentation induction of mutant enzymes
[0056] Inoculate BL21(DE) Escherichia coli with recombinant plasmid pRSF-UGT-SUS in 100mL LB liquid medium (containing 50μg / mL kanamycin), culture at 37°C, 200r / min until OD600 reaches 2-3, add Inducer lactose to a final concentration of 1g / L, 25 ° C, 200r / min conditions induced 20h. The fermentation broth was centrifuged at 4°C and 6000 / min for 3 minutes, resuspended in 8 mL of 100 mM potassium phosphate buffer (pH8.0), and the mutant enzyme was extracted using an ultrasonic breaker. Breaking conditions: 300W, working time 1s, intermittent 2s, the whole 15min. Centrifuge the broken solution at 4°C for 25 minutes at 8000 r / min, and collect the supernatant. Heart 10min, collect the supernatant.
Embodiment 3
[0057] Example 3 Method for Determination of Conversion Rate of Glycosyltransferase Mutant and Sucrose Synthase Coupled Double Enzyme
[0058] The method for the determination of glycosyltransferase activity is: in a 220 μl reaction system (0.5 mM quercetin, 5 mM UDPG, 5 mM MgCl 2 , ph-7.2 potassium phosphate buffer), add crude enzyme solution with a final protein concentration of 3 mg / ml for reaction, react at 37°C for 30 minutes, take 220 μl of reaction solution, add 180 μl of methanol to stop the reaction, centrifuge at 12,000 rpm for 1 min, and load The supernatant was analyzed by high performance liquid chromatography (HPLC). The enzyme activity unit is defined as: under the above reaction conditions, the amount of enzyme required to catalyze the formation of 1 μmol isoquercitrin in 1 min is 1 activity unit (U).
[0059] The method for measuring the enzyme activity of sucrose synthase: add 6mg of protein to 3ml reaction system (500mM sucrose, 10mM UDP, ph=7.2 potassium p...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 