Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of biosynthesis method of quercetin glycoside

A quercetin glycoside and biosynthesis technology, applied in the field of genetic engineering, to achieve good application prospects, increase conversion rate and product yield, and mild synthesis conditions

Active Publication Date: 2021-09-03
NANJING TECH UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The microbial transformation method is one-step transformation, the process is simple, and it is easy to control. At present, there are few domestic reports on the preparation of quercetin-3,4'-diglucoside

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Preparation of Glycosyltransferase Mutants

[0029] (1) Single mutation

[0030] Two mutants V371A derived from onion glycosyltransferase UGT73G1, the amino acid sequence formula of SEQ ID NO.2, F381Y, shown in the amino acid sequence formula of SEQ ID NO.3;

[0031] According to the gene sequence of glycosyltransferase UGT73G1, site-directed mutagenesis was performed, the DNA coding sequence was determined, and introduced into Escherichia coli for expression to obtain a single mutant glycosyltransferase. The single mutants V371A and F381Y were synthesized by GenScript Biotechnology Co., Ltd. Constructed onto the pet28a vector.

[0032] The primers for site-directed mutagenesis of V371A are:

[0033] Forward primer:

[0034] TAAGAAGGAGATATACATATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTG

[0035] Reverse primer:

[0036] GGTTTCTTTACCAGACTCGAGTCATTA GTGGTGGTGGTGGTGGTG TTTGTTGCGACGGTC

[0037] The primers for site-directed mutagenesis of F381Y are:

[0038]...

Embodiment 2

[0055] Example 2 Fermentation induction of mutant enzymes

[0056] Inoculate BL21(DE) Escherichia coli with recombinant plasmid pRSF-UGT-SUS in 100mL LB liquid medium (containing 50μg / mL kanamycin), culture at 37°C, 200r / min until OD600 reaches 2-3, add Inducer lactose to a final concentration of 1g / L, 25 ° C, 200r / min conditions induced 20h. The fermentation broth was centrifuged at 4°C and 6000 / min for 3 minutes, resuspended in 8 mL of 100 mM potassium phosphate buffer (pH8.0), and the mutant enzyme was extracted using an ultrasonic breaker. Breaking conditions: 300W, working time 1s, intermittent 2s, the whole 15min. Centrifuge the broken solution at 4°C for 25 minutes at 8000 r / min, and collect the supernatant. Heart 10min, collect the supernatant.

Embodiment 3

[0057] Example 3 Method for Determination of Conversion Rate of Glycosyltransferase Mutant and Sucrose Synthase Coupled Double Enzyme

[0058] The method for the determination of glycosyltransferase activity is: in a 220 μl reaction system (0.5 mM quercetin, 5 mM UDPG, 5 mM MgCl 2 , ph-7.2 potassium phosphate buffer), add crude enzyme solution with a final protein concentration of 3 mg / ml for reaction, react at 37°C for 30 minutes, take 220 μl of reaction solution, add 180 μl of methanol to stop the reaction, centrifuge at 12,000 rpm for 1 min, and load The supernatant was analyzed by high performance liquid chromatography (HPLC). The enzyme activity unit is defined as: under the above reaction conditions, the amount of enzyme required to catalyze the formation of 1 μmol isoquercitrin in 1 min is 1 activity unit (U).

[0059] The method for measuring the enzyme activity of sucrose synthase: add 6mg of protein to 3ml reaction system (500mM sucrose, 10mM UDP, ph=7.2 potassium p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a biosynthesis method of quercetin glycosides. The gene of the glycosyltransferase UGT73G1 mutant is connected with the sucrose synthase gene to obtain a recombinant plasmid, and a recombinant bacterium containing a double-enzyme system is constructed; the recombinant bacterium is inoculated in LB In liquid culture medium, cultivate, add inducer lactose to induce, fermented liquid is centrifuged to collect bacteria, the bacteria are broken, centrifuged to collect supernatant to obtain crude enzyme liquid; dissolve quercetin or isoquercetin in DMSO, add crude Enzyme solution, sucrose, reaction, and centrifugation to obtain supernatant quercetin-3,4'-diglucoside. The amino acid sequence of the glycosyltransferase UGT73G1 mutant is an amino acid sequence in which V371A and / or F381Y mutations occur in the sequence shown in SEQ ID NO:1. The mutant is simple to prepare, has a large yield, and realizes an increase in the yield of quercetin-3,4' diglucoside.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a biosynthesis method of quercetin glycoside. Background technique [0002] Quercetin, also known as quercetin and quercetin yellow, as a natural flavonoid compound, widely exists in the flowers, leaves and fruits of plants, mostly in the form of glycosides, and has a good expectorant effect , Antitussive effect. In addition, it has the effects of lowering blood pressure, enhancing capillary resistance, reducing capillary fragility, lowering blood lipids, expanding coronary arteries, and increasing coronary blood flow. In the United States, quercetin is an over-the-counter drug for treating prostate cancer, but in China, it has not been approved as a prostate treatment drug. Quercetin is insoluble in water. The introduction of hydrophilic groups can increase its solubility and facilitate absorption, thereby enhancing its pharmacological effects. Glycosyl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12P19/18C12P19/60
CPCC12P19/18C12P19/60
Inventor 贾红华李艳蔡如鑫严明陈可泉
Owner NANJING TECH UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com