Unlock instant, AI-driven research and patent intelligence for your innovation.

Gene GhABC related to resistance to cotton verticillium wilt, and encoding protein and applications thereof

A technology for resistance to verticillium wilt and related proteins, which can be applied in the field of agricultural biology and can solve problems such as harm to cotton yield

Active Publication Date: 2019-05-03
INST OF COTTON RES CHINESE ACAD OF AGRI SCI
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] Cotton is an important textile raw material and an important economic crop. However, as a worldwide disease, cotton verticillium wilt has caused great harm to cotton production. As a soil-borne vascular disease, the disease has no ideal The prevention and control measures of the disease-resistant varieties through genetic engineering have become an important technical means to solve the cotton verticillium wilt

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene GhABC related to resistance to cotton verticillium wilt, and encoding protein and applications thereof
  • Gene GhABC related to resistance to cotton verticillium wilt, and encoding protein and applications thereof
  • Gene GhABC related to resistance to cotton verticillium wilt, and encoding protein and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1 obtains cotton gene GhABC

[0028] Zhimian 2, a disease-resistant variety, and Jimian 11, a susceptible variety, were used as plant materials. After inoculating the cotton Verticillium wilt pathogen Vd080, the whole cotton protein was extracted, and the cotton not inoculated with the pathogen was used as the blank control. Enzymatic hydrolysis of the extracted whole protein with trypsin, using metal oxide TiO 2 The affinity for phosphate groups enables the enrichment of phosphorylated peptides containing serine (S), threonine (T), and tyrosine (Y), and the use of groups with high affinity for acetylated lysine Sequence antibody, which specifically enriches acetylated peptides in complex samples, uses motif antibodies with high affinity for ubiquitinated lysine, specifically enriches ubiquitinated peptides in complex samples, and differently modified The enrichment is subjected to liquid mass spectrometry (LC-MS / MS) protein quantitative method to realize qu...

Embodiment 2

[0030] The expression of GhABC in cotton after the treatment of embodiment 2 pathogenic bacteria and hormone

[0031] The resistant cotton variety Zhongzhimian 2 and the susceptible variety Jimian 11 were planted in vermiculite sandy soil paper pots as experimental materials.

[0032] Vd080 spore suspension was inoculated after root injury, and root RNA was extracted at 12h, 24h, 48h and 72h, respectively.

[0033] with 0.5mM hydrogen peroxide (H 2 o 2 ), 0.1mM salicylic acid (SA), 0.15mM methyl jasmonate (JA) and 1mM ethylene (ET) were sprayed until the leaves dripped, and root RNA was extracted at 12h, 24h, 48h and 72h, respectively.

[0034] The fluorescent quantitative primers were designed as: GhABC-F:TTCAGCCTGTTGGTCGTG, GhABC-R:GCGGGATTATTATGTCCTTG. The expression of GhABC was detected after pathogenic bacteria and hormone treatment.

[0035] Such as figure 1 It was shown that the expression of GhABC in susceptible and resistant varieties was inhibited at the initia...

Embodiment 3

[0037] Example 3. The use of virus-mediated gene silencing technology (VIGS) to study the function of GhABC

[0038] 1. Silencing the gene GhABC in cotton

[0039] Design of primers for GhABC silencing vector

[0040] ABC-VIGS-F:GCTCTAGATCAGAAACACCGTGGACA,

[0041] ABC-VIGS-R: GGGGTACCTTAACTCATTTACTAACGCCTT.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of agricultural biotechnology, and specifically relates to a gene GhABC related to resistance to cotton verticillium wilt, and encoding protein and applications thereof. The nucleotide sequence of the gene GhABC related to resistance to cotton verticillium wilt is as shown in SEQ ID No.2, and the amino acid sequence of the encoding protein is as shown in SEQ ID No.1. After a gene silencing plant is inoculated with a spore suspension of cotton verticillium wilt pathogen Vd080, the silencing plant is more susceptible to disease. It is, by the mechanism research, found that when the synthesis of xylem and tannin in the silencing plant decreases, the ROS decreases and the expression of some defense genes is regulated down. The studies demonstrate that the GhABC is positively correlated with the resistance to cotton verticillium wilt, and the GhABC can be used as a candidate gene for cotton disease-resistance breeding.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, and in particular relates to the cotton Verticillium wilt resistance related gene GhABC and its encoded protein and application. Background technique [0002] Cotton is an important textile raw material and an important economic crop. However, as a worldwide disease, cotton verticillium wilt has caused great harm to cotton production. As a soil-borne vascular disease, the disease has no ideal The prevention and control measures of cotton and the selection of disease-resistant varieties through genetic engineering have become an important technical means to solve cotton verticillium wilt. Contents of the invention [0003] The object of the present invention is to provide a cotton Verticillium wilt resistance phase gene GhABC. [0004] Another object of the present invention is to provide the encoded protein of the above gene. [0005] Another object of the present invention is a reco...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N1/21A01H5/00A01H6/60
Inventor 冯鸿杰周京龙朱荷琴冯自力魏锋师勇强赵丽红袁媛
Owner INST OF COTTON RES CHINESE ACAD OF AGRI SCI