Porcine circovirus type 2 double antibody sandwich ELISA reagent kit and application thereof
A porcine circovirus and double antibody sandwich technology, applied in the biological field, can solve the problems of unverified sensitivity, poor specificity, poor sensitivity, etc., and achieve the effects of short detection period, strong specificity and low production cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] The preparation of embodiment 1 anti-PCV2 Cap monoclonal antibody
[0050] Using the ORF2 gene sequence of PCV2b ZJ strain as a template (accession number: HM776453.1), the following primers were designed:
[0051] P1: TCACTTAGGGTTAAGTGGGGG (SEQ ID No. 1)
[0052] P2: ACGTATCCAAGGAGGCGTTT (SEQ ID No. 2)
[0053] Using the PCV2b strain sequence as a template, using P1 and P2 as primers, amplify the PCV2 ORF2 gene (the amplified sequence is SEQ ID No.3), and simultaneously cut the gene and the PMD-18T vector with BamHI and XhoI, and connect with T7 Enzyme ligation to obtain the recombinant plasmid PMD-18T-ORF2. Then, the recombinant plasmid was transferred into the expression system of Escherichia coli by thermal transformation method, and the recombinant expression strain pGEX-4T-1-CAP / BL21 was constructed.
[0054] During the fermentation and culture process of recombinant bacteria expressing the target protein, IPTG was used as an inducer, and the fermentation broth...
Embodiment 2
[0056] The preparation of embodiment 2 porcine anti-PCV2 polyclonal antibody
[0057] 2 piglets were tested by PCR and serum antibody, and it was confirmed that they were not infected with PCV2. They were reared separately, with one as the control group and one as the experimental group. The PCV2 virulent strain was used for infection, blood was collected after 7 days, 14 days and 21 days after infection, and serum was collected. Porcine circovirus 2-dCap-Elisa antibody detection kit (Rip (Baoding) Bio-Pharmaceutical Co., Ltd.) was used for antibody detection. For detailed steps, refer to the instructions. The results showed that piglets could produce specific antibodies 7 days after PCV2 infection, and the S / P value was >0.25, which could be used as a standard positive serum; while the serum antibody S / P<0.16 of the uninfected control pigs was negative.
Embodiment 3
[0058] Example 3 Purification of Monoclonal Antibody and Polyclonal Antibody
[0059] 1 Materials and methods
[0060] 1.1 Experimental materials
[0061] 0.06M sodium acetate-acetic acid buffer (PH5.0), 0.01M HAC, 1M NaOH, saturated (NH4)2SO4, PBS (0.01M, PH=7.4), dialysis bag (Biotopped, molecular weight cut off 8000-14000) , caprylic acid, PH meter.
[0062] 1.2 Experimental method
[0063] The anti-PCV2 polyanti-pig serum was centrifuged at 3000rpm for 10min, and the supernatant was aspirated. Add acetate buffer (0.06M, pH=5.0) at a ratio of 1:2, stir while adding, and adjust to pH=4.5 with 0.01mol / L HAC. Add octanoic acid while stirring (75 μl octanoic acid per ml of serum), continue stirring for 30 min, and stand at 4°C for 2 h. Centrifuge at 12,000 rpm at 4°C for 30 minutes, discard the precipitate; adjust the pH of the supernatant to 7.4 with 1M NaOH. While stirring, add saturated (NH4)2SO4 placed at 4°C to make the concentration reach 45%, continue to stir for 3...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com