Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Heat-resisting gene CRY1 and application thereof, microzyme and preparation method and application of microzyme

A yeast and gene technology, applied in the field of molecular biology, can solve problems such as direct signal pathways are not very clear, and achieve the effects of avoiding climate warming, improving heat resistance, and improving adaptability

Active Publication Date: 2019-07-19
HENAN AGRICULTURAL UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, whether there are direct signaling pathways in plants in response to light and heat shocks is still not very clear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Heat-resisting gene CRY1 and application thereof, microzyme and preparation method and application of microzyme
  • Heat-resisting gene CRY1 and application thereof, microzyme and preparation method and application of microzyme
  • Heat-resisting gene CRY1 and application thereof, microzyme and preparation method and application of microzyme

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] A heat-resistant gene CRY1, the gene sequence of which is shown in SEQ ID NO.1, specifically:

[0038]ATGTCTGGTTCTGTATCTGGTTGTGGTTCTGGTGGTTGTAGTATTGTATGGTTTAGAAGAGATCTTAGGGTTGAAGATAATCCAGCTTTAGCAGCAGCAGTAAGAGCTGGTCCAGTGATTGCTCTGTTTGTTTGGGCACCAGAAGAAGAAGGACACTATCATCCAGGTAGGGTTTCTAGGTGGTGGCTCAAGAACAGTTTGGCTCAGCTTGATTCTTCTCTTAGAAGTCTTGGTACTTGTCTTATCACCAAGAGATCTACTGATAGTGTTGCTTCTCTTCTTGATGTTGTTAAATCCACTGGTGCTTCTCAGATCTTCTTCAACCATTTGTATGATCCATTGTCTTTGGTGCGTGATCACCGAGCTAAAGATGTTTTGACGGCGCAAGGCATAGCGGTTCGATCATTCAACGCAGACTTGCTTTATGAGCCATGGGAAGTGACTGATGAATTAGGCCGTCCTTTCTCTATGTTTGCTGCGTTTTGGGAGAGATGTCTTAGTATGCCTTATGACCCTGAGTCTCCTCTTCTTCCACCTAAGAAGATCATTTCAGGGGATGTGTCTAAATGTGTTGCGGATCCATTGGTGTTTGAGGATGACTCTGAGAAAGGAAGCAATGCACTTCTGGCTCGTGCTTGGTCTCCTGGATGGAGTAATGGTGATAAAGCTCTCACAACGTTTATAAACGGTCCATTGCTTGAATACTCTAA GAACCGCAGA AAAGCCGATA GTGCTACAACCTCGTTTCTTTCTCCACACT TGCATTTTGG GGAAGTGAGTGTGAGAAAAGTTTTTCATCTTGTTCGGATCAAACAGGTCGCGTGGGCAAACGAAGGAAACGAGGCCGGGGAAGAAAGCGTGAATCTTTTCCTGAAATCTA...

Embodiment 2

[0042] The application of the CRY1 gene in a kind of embodiment 1 aspect improving plant heat tolerance, its application method is:

[0043] The seedlings of monocot wheat and dicotyledonous rapeseed (all containing CRY1 gene in these two plants) grown for 4 days at 22°C in a dark light incubator were treated in three groups:

[0044] The first group continued to be treated in the dark at 22°C;

[0045] The second group was treated with white light at 22°C for 1 hour;

[0046] The third group was treated at 34°C and in the dark.

[0047] The seedlings after the three treatments were subjected to lethal heat stress treatment at 45°C for 2 hours, and finally placed under normal growth conditions for 7 days.

[0048] Investigate the survival of plants after high temperature treatment. For inspection results, see image 3 .

[0049] image 3 A is the plant survival of monocot wheat after high temperature treatment. image 3 B is the plant survival situation of dicotyledonou...

Embodiment 3

[0051] The application of the CRY1 gene in a kind of embodiment 1 aspect improving microbial heat resistance, its application method is:

[0052] HSE-YFP is a heat shock response reporter system, HSE is the heat shock element, the heat shock response main factor HSF1 is combined with HSE, HSE will start the expression of YFP fluorescent fluorescent protein, and the fluorescence can be observed under the fluorescence microscope, which can be measured according to the fluorescence The intensity of protein fluorescence was used to judge the activity degree of heat shock response.

[0053] The HSE-YFP reporter system was transformed into wild-type strain w303a, pNH604-mKate-transformed strain, pNH604-CRY1-mKate-transformed strain and pNH604-CRY1-mKate-NLS-transformed yeast strain (the protein encoded by the mKate gene is a fluorescent protein , as the tag of CRY1 protein, which can make the CRY1 gene be observed inside the cell), and the fluorescence intensity of each strain was m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a heat-resisting gene CRY1 and an application thereof, microzymes and a preparation method and application of the microzymes. The heat-resisting gene CRY1 is a gene which can arouse a heat shock reaction of plants, the microzymes and human cells and increase heat resistance, and can be applied to increasing the high temperature resistant capacity of plants, animals and microorganisms and increasing the resistance of the microorganisms to toxic protein. The invention also provides the microzymes with the heat-resisting gene CRY1 in a shifting manner. The preparation method of the microzymes comprises the steps of enabling a PCR amplification product having a CRY1 sequence to be connected with a carrier to obtain recombinants, transforming the recombinants to escherichia coli, and performing extraction to obtain plasmid; and transforming plasmid DNA and denaturated salmon roe DNA into competence yeast so as to obtain the heat-resisting microzymes containing pNH604-CRY1-mKate-NLS. The heat-resisting microzymes have high high-temperature resistant capacity, influence of high temperature to fermentation flavor and yield of metabolism products can be avoided, andthe heat-resisting microzymes have great prospects in the field of foods, medicines and the like.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a heat-resistant gene CRY1 and its application, yeast and its preparation method and application. Background technique [0002] In the past century, the global climate has shown a warming trend. Climate change will increase the possibility of crop heat damage, which will seriously affect the yield of crops and affect my country's food security. [0003] Since plants are fixed on the land and cannot move, they must integrate the surrounding environmental signals and adapt to changes in the environment by adjusting growth, development and metabolism. The perception of light and temperature in the environment is particularly important for plants. Plants perceive light through a series of photoreceptors. Higher plants have formed a complete set of sophisticated photoreceptor systems and light signal transduction systems during the long-term evolution process, which partic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N1/19C12N15/81C12R1/645
CPCC07K14/415C12N15/81
Inventor 郑旭高洁张燕吉满春
Owner HENAN AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com