Thellungiella salsuginea transcription factor EsMYB41 for controlling plant anthocyanin synthesis and encoding gene and application thereof
A technology of transcription factors and coding genes, which is applied in the field of agricultural biology, can solve the problems that there are no research reports on important regulatory functions, and achieve the effect of improving antioxidant capacity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1 The cDNA Cloning of EsMYB41 Gene Synthesis Regulated by Salt Brassicacyanin
[0037] For the 20-day-old Salt mustard seedlings, Trizol was used to extract the total RNA of Salt mustard. cDNA was obtained by reverse transcription with Superscript II (Invitrogen) reverse transcriptase. Primers P1 and P2 were designed according to the sequence of EsMYB41 gene coding region. Using the cDNA obtained by reverse transcription as a template, PCR amplification was performed with primers P1 and P2. The sequences of primers P1 and P2 are as follows:
[0038] P1: 5'TTTAGAATACTTATTGGTCC 3'
[0039] P2: 5'ATCAGAGACAGATATTAGTTGG 3'
[0040] The PCR product was detected by 0.8% agarose gel electrophoresis, and a band with a molecular weight of about 0.86kb was obtained. This fragment included the coding region of EsMYB41 and the 5' and 3'-UTR regions of about 110bp, and the size was consistent with the expected result.
[0041] Recover the fragment, connect the recovered...
Embodiment 2
[0044] Embodiment 2 uses EsMYB41 gene to improve anthocyanin synthesis and antioxidant capacity of plants
[0045] 2.1 Construction of recombinant expression vector
[0046] Use the cDNA obtained by reverse transcription of the total RNA of Saltina japonica as a template, and perform PCR amplification with specific primers containing EcoRI and BamHI linker sequences; then EcoRI and BamHI double enzyme digestion PCR products are recovered, and the enzyme digestion products are inserted into the vector pCAMBIA3301H in the forward direction Between the EcoRI and BamHI restriction sites behind the 35S promoter, the recombinant vector 35S::EsMYB41 was obtained. The primer sequences are as follows:
[0047] 35S-EsMYB41[EcoRI]: 5' CCGGAATTCTTTAGAATACTTATTGGTCC 3'
[0048] 35S-EsMYB41[BamHI]: 5'CGCGGATCCATCAGAGACAGATATTAGTTGG 3'
[0049] 2.2 Enhancing anthocyanin synthesis in plants with EsMYB41 gene
[0050] 1) Obtain transgenic tobacco and Arabidopsis materials
[0051] The rec...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap