Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Thellungiella salsuginea transcription factor EsMYB41 for controlling plant anthocyanin synthesis and encoding gene and application thereof

A technology of transcription factors and coding genes, which is applied in the field of agricultural biology, can solve the problems that there are no research reports on important regulatory functions, and achieve the effect of improving antioxidant capacity

Inactive Publication Date: 2019-07-30
SHANDONG NORMAL UNIV
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Salt mustard (Eutrema Salsugineum) is a typical halophytic plant, it can adapt to salt stress environment, can resist the stress of 500mM NaCl in a short time, and has high tolerance to cold, drought, oxidative stress and nitrogen deficiency , the prior art uses the salt mustard to carry out studies on the physiological, metabolic and molecular mechanisms related to stress tolerance, including ion transport, gene expression, etc., but the important regulatory role of the salt mustard MYB transcription factor in anthocyanin biosynthesis is still unknown. research report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Thellungiella salsuginea transcription factor EsMYB41 for controlling plant anthocyanin synthesis and encoding gene and application thereof
  • Thellungiella salsuginea transcription factor EsMYB41 for controlling plant anthocyanin synthesis and encoding gene and application thereof
  • Thellungiella salsuginea transcription factor EsMYB41 for controlling plant anthocyanin synthesis and encoding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 The cDNA Cloning of EsMYB41 Gene Synthesis Regulated by Salt Brassicacyanin

[0037] For the 20-day-old Salt mustard seedlings, Trizol was used to extract the total RNA of Salt mustard. cDNA was obtained by reverse transcription with Superscript II (Invitrogen) reverse transcriptase. Primers P1 and P2 were designed according to the sequence of EsMYB41 gene coding region. Using the cDNA obtained by reverse transcription as a template, PCR amplification was performed with primers P1 and P2. The sequences of primers P1 and P2 are as follows:

[0038] P1: 5'TTTAGAATACTTATTGGTCC 3'

[0039] P2: 5'ATCAGAGACAGATATTAGTTGG 3'

[0040] The PCR product was detected by 0.8% agarose gel electrophoresis, and a band with a molecular weight of about 0.86kb was obtained. This fragment included the coding region of EsMYB41 and the 5' and 3'-UTR regions of about 110bp, and the size was consistent with the expected result.

[0041] Recover the fragment, connect the recovered...

Embodiment 2

[0044] Embodiment 2 uses EsMYB41 gene to improve anthocyanin synthesis and antioxidant capacity of plants

[0045] 2.1 Construction of recombinant expression vector

[0046] Use the cDNA obtained by reverse transcription of the total RNA of Saltina japonica as a template, and perform PCR amplification with specific primers containing EcoRI and BamHI linker sequences; then EcoRI and BamHI double enzyme digestion PCR products are recovered, and the enzyme digestion products are inserted into the vector pCAMBIA3301H in the forward direction Between the EcoRI and BamHI restriction sites behind the 35S promoter, the recombinant vector 35S::EsMYB41 was obtained. The primer sequences are as follows:

[0047] 35S-EsMYB41[EcoRI]: 5' CCGGAATTCTTTAGAATACTTATTGGTCC 3'

[0048] 35S-EsMYB41[BamHI]: 5'CGCGGATCCATCAGAGACAGATATTAGTTGG 3'

[0049] 2.2 Enhancing anthocyanin synthesis in plants with EsMYB41 gene

[0050] 1) Obtain transgenic tobacco and Arabidopsis materials

[0051] The rec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of agricultural biology, and particularly relates to a thellungiella salsuginea transcription factor EsMYB41 for controlling plant anthocyanin synthesis and an encoding gene and application thereof. The amino acid sequence of the thellungiella salsuginea transcription factor EsMYB41 for controlling plant anthocyanin synthesis is shown in SEQ ID No.1. Byconstructing an EsMyb41 containing over expression vector, tobacco and arabidopsis are transferred, and EsMYB41 transgenic tobacco and arabidopsis are obtained; results find that the transgenic planthas the almost whole-plant claret-colored phenotype; the anthocyanin content of different tissues of transgenic plants and the expression of the anthocyanin synthesis structure gene are both remarkably higher than the wild type, and meanwhile under the salt stress, the anti-oxidase capability of the transgenic plant is improved remarkably.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, and in particular relates to a mustard transcription factor EsMYB41 for regulating plant anthocyanin synthesis, its coding gene and application. Background technique [0002] Anthocyanins are flavonoid substances produced during plant metabolism, which determine the color of angiosperm flowers, fruits, seed coats, stems, leaves and roots. In ornamental plant varieties, anthocyanins play an irreplaceable role in imparting flower color to plants. At the same time, anthocyanins can increase the attractiveness of pollinators and facilitate seed dispersal. Therefore, for many fruits and flowers, anthocyanins are an important quality characteristic and an important basis for breeding. Since anthocyanins can scavenge oxygen free radicals produced in cells, they have antioxidant activity. The antioxidant activity of anthocyanins depends on the degree of hydroxylation, acylation and glycosylat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/00A01H6/20A01H6/82
CPCC07K14/415C12N15/825
Inventor 张荃王兴军高世庆谷彩红李长生亓玉婷
Owner SHANDONG NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com