A method for yeast biosynthesis of conotoxin
A technology of conotoxin and Pichia pastoris, applied in biochemical equipment and methods, peptide preparation methods, botany equipment and methods, etc., can solve the problems of conotoxins restricting pharmacological research and application, high cost of conotoxins, etc. , to achieve the effects of low cost, easy large-scale production, and high expression efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] CalTx total gene synthesis
[0028] According to the CalTx protein sequence (NCPAGCRSQGCCM), optimize the codon gene fragments preferred by yeast. Restriction enzyme sites were introduced at both ends of the gene sequence Sph I. Stu I, synthetic primers are shown in Table 1. Take 5uL each of the corresponding upstream and downstream primers (100 µmol / L), add 40uL sterile water, and mix well. Denature at 98°C for 1 min, stop the reaction immediately, cool down naturally on the PCR machine, and then place it on ice for 10 min. that is completed separately CalTx total gene synthesis. -20 Store in the refrigerator.
[0029] Table 1
[0030]
Embodiment 2
[0032] (1) Transform the pPink-HC plasmid: first insert the secretion signal a-mating factor into the EcoR I and Sph I double-enzyme-digested plasmid pPink-HC, transforming the plasmid into a secretory expression plasmid pPink-HC-MF; followed by adding sfGFP as a screening signal. The specific operation is to insert the PCR-amplified sfGFP into the Stu I and Fse From the pPink-HC-MF digested with I double enzymes, pPink-HC-MF-GFP was successfully constructed; the sequences of a-mating factor and sfGFP were as follows:
[0033] a-mating factor:
[0034] atgagatttccttcaatttttactgcagttttattcgcagcatcctccgcattagctgctccagtcaacactacaacagaagatgaaacggcacaaattccggctgaagctgtcatcggttacttagatttagaaggggatttcgatgttgctgttttgccattttccaacagcacaaataacgggttattgtttataaatactactattgccagcattgctgctaaagaagaaggggtatctttggataaaaga;
[0035] sfGFP:
[0036]TCCAAAGGAGAAGAGCTGTTCACTGGGGTTGTACCCATTTTGGTAGAACTGGACGGAGATGTAAACGGACATAAATTCTCTGTTAGAGGTGAGGGCGAAGGCGATGCCACCAATGGTAAATTGACTCTGAAGTTTATAT...
Embodiment 3
[0040] Induced expression and detection of recombinant yeast
[0041] Mix 80 ul prb1 and pep4 dual protease-deficient Pichia competent cells with 5 µg EcoN After the linearized plasmids were mixed, they were transferred to an electroporation cup and kept in an ice bath for 5 minutes. Immediately after the electric shock, add 1ml of YPDS to the electric cup, shake it up and down to mix. Incubate at 28°C for 2h. After mixing evenly, pipette 300 µl of the bacterial solution and spread it on the PAD plate, and incubate at 28°C for 3-7 days. Pick 3-8 white single clones with large colonies, streak on the surface of the PAD plate again, culture at 28°C for 3-7 days, and transfer the constructed expression plasmid into PichiaPink Strain 4. Pick a single colony and incubate at 30°C with shaking at 280rpm. Culture bacteria concentration to OD 600 =2~6, replaced with BMMY medium. Every 24h, add methanol to a final concentration of 0.5wt%. After fermenting for 120 hours, the col...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More