Construction method of methanol bioconversion strain, and constructed strain and application thereof

A technology for biotransformation and construction methods, applied in microorganism-based methods, biochemical equipment and methods, microorganisms, etc., and can solve the problems of limiting the development and application of methanol biotransformation, inability to realize methanol, and inability to utilize methanol.

Pending Publication Date: 2020-02-07
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In 2016, researchers such as Price in the United States used Mdh, Hps and Phi multi-enzyme complexes to improve methanol utilization efficiency. However, even with the application of this multi-enzyme complex, it is still impossible to use methanol as the sole carbon source for growth, and can only be catalyzed by resting cells. Methanol method to realize methanol biotransformation (Price, J.V., Chen, L., Whitaker, W.B., Papoutsakis, E., Chen, W., 2016. Scaffoldless engineered enzyme assembly for enhanced methanolutilization.Proc.Natl.Acad.Sci. U.S.A.113, 12691-12696)
In the same year, researchers such as Rohlhill in the United States used formaldehyde-inducible promoters to control the expression of methanol utilization-related genes. Although the efficiency of methanol utilization can be improved, the growth of genetically engineered strains still requires yeast powder and methanol as carbon sources (Rohlhill, J. ,Sandoval,N.R.,Papoutsakis,E.T.,2017.Sort-seq approach to engineering a formaldehyde-inducible promoter for dynamically regulated Escherichia coli growth onmethanol.ACS Synth.Biol.6,1584-1595)
In 2017, Chinese researchers used the linear methanol biotransformation pathway instead of the commonly used RuMP pathway to construct E.coli that biotransforms methanol, although 13 C labeling experiments confirmed that methanol was used by genetically engineered strains to synthesize some metabolites, but the strains still could not use methanol as the sole carbon source for growth (Wang, X., Wang, Y., Liu, J., Li, Q., Zhang, Z .,Zheng,P.,Lu,F.,Sun,J.,2017.Biological conversion of methanol by evolved Escherichia coli carrying a linear methanolassimilation pathway.Bioresour Bioprocess 4,41)
The research team replaced sarcosine oxidase Sox with Mdh, and tried to use methanol instead of sarcosine, but the obtained genetically engineered strains were still unable to utilize methanol in the presence of xylose as an additional carbon source
[0010] Due to the difficulty and complexity of methanol biotransformation research work, no research institutions or companies at home and abroad have constructed platform strains that can use methanol as the only carbon source for growth, which greatly limits the development and application of methanol biotransformation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of methanol bioconversion strain, and constructed strain and application thereof
  • Construction method of methanol bioconversion strain, and constructed strain and application thereof
  • Construction method of methanol bioconversion strain, and constructed strain and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0117] Example 1. Expression of xylose isomerase gene in Corynebacterium glutamicum

[0118] The xylose isomerase gene is expressed in Corynebacterium glutamicum (C. glutamicum), and the Corynebacterium glutamicum that can utilize xylose to grow is constructed.

[0119] (1) Using the genomic DNA of E.coli MG1655 as a template, using single-stranded nucleotides xylA-F (gaaacagaattaattaagcttccaaaggagttgagaatgcaagcctattttgaccag, SEQ ID NO: 1) and xylA-R (caaaac agccaagctgaattcttatttgtcgaacagataatggttt, SEQ ID NO: 2) as primers, by The PCR method is used to amplify the fragment of the xylose isomerase coding gene xylA.

[0120] (2) Digest the plasmid pXMJ19 with restriction endonucleases HindIII and EcoRI to linearize the plasmid.

[0121] (3) The above xylA fragment was ligated with the linearized pXMJ19 plasmid using the ClonExpress II One Step Cloning Kit (Nanjing Novizan Biotechnology Co., Ltd.) to construct the pXMJ19-xylA plasmid.

[0122] (4) References (Ruan, Y., Zhu, L....

Embodiment 2

[0123] Example 2. Knockout ribose phosphate isomerase gene in Corynebacterium glutamicum

[0124] The present inventors knocked out the ribose phosphate isomerase gene rpiB in the strain C. glutamicum ATCC 13032ΔadhEΔald (pXMJ19-xylA).

[0125] (1) Using the genomic DNA of C. glutamicum ATCC 13032 as a template, using single-stranded nucleotides ΔrpiB-F1 (gagctcggtacccggggatccctcattccgtttcgcagcat, SEQ ID NO: 3) and ΔrpiB-R1 (ggtgcgattccgtggtctgctccaaggtatac, SEQ ID NO: 4) as primers, by The PCR method is used to amplify the upstream homology arm fragment for knocking out the rpiB gene.

[0126] (2) Using the genomic DNA of C. glutamicum ATCC 13032 as a template, using single-stranded nucleotides ΔrpiB-F2 (gcagaccacggaatcgcacctgtcgttcctaa, SEQ ID NO: 5) and ΔrpiB-R2 (caggtcgactctagaggatccaccagacacaaaatcagcagaagta, SEQ ID NO: 6) as primers, by The PCR method is used to amplify the downstream homology arm fragment for knocking out the rpiB gene.

[0127] (3) The plasmid pK18mob...

Embodiment 3

[0130] Example 3. Ribose and xylose as carbon sources for adaptive evolution

[0131] In order to enhance the ability of the obtained bacterial strain to grow without utilizing glucose as a carbon source, the present inventors carried out adaptive evolution to the bacterial strain obtained in Example 2, specifically as follows:

[0132] (1) Use CGXII medium without glucose, add 26.6mM ribose, 26.6mM xylose, 1mM isopropylthiogalactopyranoside (IPTG) and 5mg / L chloramphenicol, and cultivate the strain C. glutamicum ATCC 13032ΔadhEΔaldΔrpiB( pXMJ19-xylA). The formula of CGXII medium refers to the literature (Keilhauer, C., Eggeling, L., Sahm, H., 1993. Isoleucine synthesis in Corynebacterium glutamicum: molecular analysis of the ilvB-ilvN-ilvC operon.J.Bacteriol.175,5595-5603) . The culture temperature is 30°C, the rotation speed of the shaker is 220rpm, the shaker flask is 250mL, and the filling volume is 50mL.

[0133] (2) After culturing for 24 hours, use the culture as a s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for constructing a methanol quick utilization strain. The method comprises the steps of firstly, constructing a methanol and xylose mandatory co-utilization basic strain, then performing adaptability evolution on the basic strain by using methanol and xylose as carbon sources to obtain a strain of which the growth rate is significantly accelerated, and finally strengthening the activity of downstream metabolic pathway relevant enzymes of ribulose 5 phosphate in the strain. The invention further discloses the constructed methanol bioconversion strain and a method for performing methanol bioconversion through the strain. Through the strain disclosed by the invention, the methanol and the xylose can be used as the carbon sources, even the methanol is used as the only carbon source, methanol bioconversion is performed, and the conversion efficiency of the methanol is significantly improved. The invention further discloses mutants of some enzymes in the strain, and a method for performing methanol bioconversion through the mutants.

Description

technical field [0001] The present invention relates to the field of biotechnology. Specifically, the present invention relates to a method for improving the methanol bioconversion efficiency of bacterial strains, the bacterial strain obtained by the method, and the application of the method and the obtained bacterial strain in the bioconversion of methanol. Background technique [0002] Methanol is a liquid one-carbon resource, a primary platform product for coal chemical industry, shale gas chemical industry, and gasification of industrial and agricultural waste, as well as an important chemical raw material. Methanol can be synthesized in various ways and from a wide range of sources. It can not only use petrochemical resources such as coal and natural gas as raw materials, but also use biomass resources such as agricultural waste straw, urban organic waste, industrial organic waste such as organic waste slag and steel factory exhaust, or carbon dioxide as a raw material...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N15/75C12N15/77C12N1/21C12P7/04C12R1/19C12R1/15C12R1/125
CPCC12N15/70C12N15/75C12N15/77C12P7/04
Inventor郑平王钰孙际宾凡立稳T·菲利伯特马延和
OwnerTIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI