A group of epothilone b glucoside compounds and their enzymatic preparation and application

A technology of epothilone and glucoside, which is applied in the application field of epothilone B glucose monosaccharide, epothilone glycoside compound and its preparation and application, and medicine, and can solve the difficulty of organic chemical synthesis method, Problems such as high synthesis cost and many by-products have achieved good social benefits and economic value, increased application value, and novel effects on targets

Active Publication Date: 2022-05-03
SHANDONG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, for the glycosylation of epothilone B with better antitumor activity, only galactosylated Epothilone B synthesized by organic chemistry, or epothilone B3-O-α-D arabinoside, other types of glycosyl Chemical products have not been reported yet
In addition, the synthesis of EpothiloneB glycosylation products by organic chemical methods is complex and cumbersome, with many by-products, difficult separation and purification, and high synthesis costs. There are also problems in organic chemical synthesis methods that are difficult, require high synthesis conditions, are highly toxic, and are not environmentally friendly. It is difficult to achieve selective protection and other defects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A group of epothilone b glucoside compounds and their enzymatic preparation and application
  • A group of epothilone b glucoside compounds and their enzymatic preparation and application
  • A group of epothilone b glucoside compounds and their enzymatic preparation and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Acquisition of Epothilone Glycosyltransferase BsGT-1 Recombinant Plasmid, Construction of I62A Mutant Recombinant Plasmid, Expression of I62A Mutant Protein, and Preparation of Epothilone B Glucoside

[0031] The inventor screened and determined the glycosyltransferase BsGT-1 (CUB50191) capable of efficiently glycosylation of epothilone B, and its protein sequence has been published. Obtaining the epothilone glycosyltransferase BsGT-1 recombinant plasmid and expressing the method for obtaining the glycosyltransferase BsGT-1 is:

[0032] The gene fragment encoding glycosyltransferase BsGT-1 was obtained by extracting the genomic DNA of B. subtilis JRS11, and double restriction primers were designed (F-BamHI: CGCGGATCCATGAAAAAGTACCATATTTCGAT; R-SalI: ACGCGTCGACTTACTGCGGGACAGCGGATTTTT). Max Super-Fidelity DNA Polymerase high-fidelity polymerase for polymerase chain reaction (PCR), reaction system: B.subtilis JRS11 genomic DNA 0.5μl; 2×PhantaMax Buffer 25μl; dNT...

Embodiment 2

[0042] The structure identification of embodiment 2 compound 1

[0043] in accordance with figure 2 , UHPLC-ESI-Q-TOF high-resolution mass spectrometry gives the quasi-molecular ion peak of compound 1 [M+H] + It is m / z670.3131, thus confirming that 1 is the monoglucoside of epothilone B. Simultaneously, the monosaccharide can also be obtained from the H NMR spectrum of compound 1 ( 1 H NMR) and carbon spectrum ( 13 C NMR) to be confirmed. In the HMBC spectrum, H-7 is related to C-1' and H-1' is related to C-7, thus confirming that the glucosyl group is connected to the 7-hydroxyl group of the epothilone B macrolide skeleton. The large coupling constant between the anomeric protons H-1' and H-2' on the sugar (J 1',2' =7.8Hz) and the chemical shift value of 4.46ppm for the high field of the anomeric proton, revealing that the glycosyl donor and the epothilone B acceptor are linked by a β-D glucosidic bond. Therefore, compound 1 is EpothiloneB 7-O-β-Dglucoside, and its spe...

Embodiment 3

[0048] The structure identification of embodiment 3 compound 2

[0049] in accordance with image 3 , the high-resolution mass spectrum gives the quasi-molecular ion peak of compound 2 [M+H] + It is m / z832.5618, which is predicted to be the diglucoside of epothilone B. The secondary mass spectrum of compound 2 gives fragment ion peaks m / z 670.3120 and 508.2615, and proton nuclear magnetic resonance spectrum ( 1 H NMR) and carbon spectrum ( 13 C NMR) provides obvious signals of two sugars, further verifying that 2 is the diglucoside of epothilone B. Similarly, HMBC and sugar terminal proton coupling constant analysis (J 1',2' =7.8Hz), it was determined that the disaccharide group was connected to epothilone B through a 7-O-β-D glucosidic bond. As for the β-1,3-glucosidic bond connection mode inside the disaccharide, it is mainly determined by two-dimensional nuclear magnetic resonance experiments, including HSQC, HMBC, COZY and NOESY. Specifically, the terminal group prot...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a group of epothilone B glucoside compounds, which are epothilone B 7‑O‑β‑D glucoside, epothilone B 7‑O‑β‑D‑glucosyl‑(1→ 3)‑β‑D-glucoside, epothilone B 7‑O‑β‑D‑glucosyl‑(1→2)‑β‑D glucoside or epothilone B 7‑O‑β‑D‑glucosyl ‑(1→2)‑β‑D‑glucosyl‑(1→4)‑β‑D glucoside. The compound is obtained from the glycosylation reaction mediated by epothilone B, UDP‑O‑β‑D‑glucose and the I62A mutant protein of glycosyltransferase BsGT‑1. The invention also discloses the application of the epothilone B glucoside compound in the preparation of medicaments for preventing and treating liver cancer. Experiments confirm that the compound epothilone B 7‑O‑β‑D glucoside of the present invention has a semi-inhibitory effect on human liver cancer cells HepG2 when the concentration is 9.84 μM; The original drug of mycin B decreased by 9430 times. It is expected to increase the application value of epothilone in antitumor activity, and enhance social benefits and economic value.

Description

technical field [0001] The present invention relates to a group of epothilone glycoside compounds and their preparation and application, in particular to epothilone B glucose monosaccharide, disaccharide, triglycoside compound and its enzymatic preparation method, and the epothilone B glucose Application of glycoside compounds in the preparation of medicines for treating and preventing liver cancer. The invention belongs to the technical field of microbial technology and its products and applications. Background technique [0002] Sorangium cellulosum belongs to Myxococcus order, Sorangium suborder, Sorangium family, Sorangium genus, is a kind of Gram-negative bacteria widely distributed in soil. Can produce abundant secondary metabolites. [0003] Epothilone (Epothilone) is a class of 16-membered macrolide compounds, currently only derived from S. cellulosus. In terms of mechanism of action, although both epothilones and paclitaxel inhibit tumor growth by polymerizing tu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07D493/04A61P35/00A61P1/16C12N9/10C12N15/70C12P19/18C12P19/62
CPCC07D493/04A61P35/00A61P1/16C12P19/62C12P19/18C12N9/1048C12N15/70
Inventor李越中张鹏吴长生汤亚杰
OwnerSHANDONG UNIV