Group b Neisseria meningitidis recombinant pili protein fim and its preparation method and application

A technology for Neisseria meningitidis and meningitis, which is applied in the field of Neisseria meningitidis recombinant fimbriae protein Fim of group B and its preparation, can solve the problems of vaccine research and marketing, and achieves good repeatability, high recovery rate, and resistance to The effect of breaking the adhesion of Neisseria meningitidis

Active Publication Date: 2021-11-05
WEST CHINA HOSPITAL SICHUAN UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no relevant vaccine research on the prevention of meningitis by blocking the adhesion of Neisseria meningitidis pili

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Group b Neisseria meningitidis recombinant pili protein fim and its preparation method and application
  • Group b Neisseria meningitidis recombinant pili protein fim and its preparation method and application
  • Group b Neisseria meningitidis recombinant pili protein fim and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0053] Further, the present invention also provides a method for preparing the above-mentioned Neisseria meningitidis recombinant pilus protein Fim, comprising the following steps:

[0054] a. Plasmid construction

[0055] The gene whose nucleotide sequence is SEQ ID NO:1 is connected in the expression vector plasmid, the plasmid is constructed and transferred into the host bacteria for induced expression;

[0056] b. Sonication, centrifugation

[0057] The bacteria obtained in the collection step a were resuspended and mixed evenly with the bacteriostasis solution, and after an ice-water bath, the bacteria were destructed by ultrasonication, centrifuged at a high speed, and the supernatant was collected;

[0058] c. Ni column affinity purification

[0059] Preliminary purification with Ni affinity packing, use liquid A to equilibrate the chromatographic column, and use liquid B to elute;

[0060] d. SP column affinity chromatography;

[0061] The target protein purified i...

Embodiment 1

[0080] Construction and identification of the recombinant plasmid pET28a / Fim of embodiment 1 Fim gene

[0081] The specific operation steps are as follows:

[0082] (1) According to the complete genome sequence of Neisseria meningitidis group B, the candidate antigen Fim (SEQ ID NO: 2) with protective immune response was screened by reverse vaccinology.

[0083] (2) According to the amino acid sequence of Fim, Escherichia coli partial tropism codon optimization was performed to obtain the target gene fragment, the sequence is SEQ ID NO: 3 (the base sequence of the restriction site is underlined).

[0084] Nucleotide sequence of SEQ ID NO:3 target gene

[0085] ccatggcggaaggccagaaaagcgcggtgaccgaatattatctgaaccacggagaatggccgggcaacaacagcagcgcgggcgtggcgaccagcgcggatattaaaggcaaatatgtgaaaagcgtggaagtgaaaaacggcgtggtgaccgcgcagatggcgagcagcaacgtgaacaacgaaattaaaggcaaaaaactgagcctgtgggcgaaacgtcaggcgggcagcgtgaaatggttttgcggcctgccggtgacccgtgcggataacgcgaaagatgatgcggtgaccgcggcggcgaccggcaccgataa...

Embodiment 2

[0097] Example 2 Induced expression, purification and identification of expression form of recombinant pilus protein Fim in prokaryotic expression system-Escherichia coli The specific operation steps are as follows:

[0098] (1) Take 100 μl of overnight cultured pET28a / Fim / BL21(DE3) bacterial solution and add it to 10 mL of kanamycin + resistant LB medium, culture overnight at 220 rpm at 37°C, take 200 μl of overnight cultured bacterial solution and add 20 mL card In the LB medium with Namycin + resistance, culture at 220rpm 37℃ for 2h, after secondary activation to OD600 of 0.8, add IPTG Isopropyl-β-D-thiosemi lactoside 10 μl to make the final concentration 0.5 mM, and then placed on a shaker at 220 rpm at 37° C. to induce expression for 4 hours.

[0099] (2) Take out the bacterial solution after induced expression, centrifuge at 5000g for 15min, discard the supernatant, add 3ml of bacteriostasis solution (50mM PB, 0.3M NaCl, pH7.4) and mix evenly, ultrasonically lyse in i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biopharmaceuticals, and in particular relates to a recombinant pilus protein Fim of group B Neisseria meningitidis and a preparation method and application thereof. The existing market lacks a vaccine that directly blocks the adhesion of Neisseria meningitidis fimbriae to prevent meningitis. The present invention provides a group B Neisseria meningitidis recombinant fimbriae protein Fim gene, the nucleotide sequence of which is As shown in SEQ ID NO:1. The present invention discovers for the first time that it is a key molecule for the adhesion and colonization of Neisseria meningitidis. It is cloned into a protein expression vector and then expressed on a large scale. After purification, it is prepared into a recombinant protein. The purity of the recombinant protein is high, reaching more than 90%. , good repeatability and high recovery rate. The protein can be used as a vaccine candidate component for preventing Neisseria meningitidis infection of group B, and has the advantages of soluble expression, easy purification, high purity, simple preparation method and the like, and has significant economic benefits.

Description

technical field [0001] The invention belongs to the technical field of biopharmaceuticals, and in particular relates to a recombinant pili protein Fim of Neisseria meningitidis group B and its preparation method and application. Background technique [0002] Meningococcus, scientific name Neisseria meningitidis (n.meninyitidis), is the pathogenic bacteria of epidemic cerebrospinal meningitis (meningitis). It is a Gram-negative diplococcus that exists in the cerebrospinal fluid of patients with acute or early meningitis, mostly located in neutrophils, and is kidney-shaped, arranged in pairs, with opposite concave surfaces. Virulent strains of meningococci can be observed under the electron microscope to have microcapsules and pili. [0003] Humans are the only susceptible host for N. meningitidis. Bacteria invade the body from the nasopharynx, relying on the action of pili to adhere to the surface of the epithelial cells of the nasopharyngeal mucosa. The pathogenesis of Ne...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/31C12N15/70C07K14/22C07K1/22A61K39/095A61P31/04
CPCA61K39/095A61P31/04C07K14/22C12N15/70
Inventor刘开云刘宇郭刚李彦王宁石云舒月力
OwnerWEST CHINA HOSPITAL SICHUAN UNIV