Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of cyclodextrinase in preparation of maltoheptaose

A maltoheptaose and cyclodextrin enzyme technology, applied in the direction of enzymes, hydrolases, glycosylases, etc., can solve the problems of reducing the effective concentration of water, reducing the molecular diffusion rate, etc., to reduce production and processing costs, simple process, The effect of simple extraction process

Inactive Publication Date: 2020-09-01
JIANGNAN UNIV
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The reason for this phenomenon may be that the high concentration of the matrix reduces the effective concentration of water and reduces the diffusion rate of the molecules

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of cyclodextrinase in preparation of maltoheptaose
  • Application of cyclodextrinase in preparation of maltoheptaose
  • Application of cyclodextrinase in preparation of maltoheptaose

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1: Cloning of cyclodextrinase-encoding gene and construction of expression vector

[0047] (1) Construction of pET-24a(+)-tscd vector

[0048] Synthetic coding nucleotide sequence such as the gene of cyclodextrinase shown in SEQ ID NO.1; the gene and pET-24a of the coding nucleotide sequence that is obtained as the cyclodextrinase shown in SEQ ID NO.1 The (+) vector was digested with restriction endonucleases NdeI and BamHI and ligated with Solution I to obtain the recombinant vector pET-24a(+)-tscd.

[0049] (2) Construction of recombinant vector

[0050] Using pET-24a(+)-tscd as a template, the target gene with a 25bp homology arm was amplified according to primers IF and IR (the nucleotide sequence is shown in SEQ ID NO.1);

[0051] Using the expression vector pUB110 as a template, the expression vector was amplified according to primers VF and VR, and the homology arm part was underlined:

[0052] IF: TAAGAAAATGAGAGGGAGAGGAAAC ATGTATAAAATTTTTGGCTTTAAAG ...

Embodiment 2

[0060] Embodiment 2: Construction of recombinant Bacillus subtilis

[0061] Transform the recombinant plasmid pUB110-TsCDase into Bacillus subtilis CCTCC M2016536, and select the transformants on the kanamycin resistance plate; pick the transformants for inoculation and culture, extract the plasmid for enzyme digestion verification and sequencing verification, and verify that it is correct That is, the recombinant Bacillus subtilis CCTCC M 2016536 / pUB110-TsCDase.

Embodiment 3

[0062] Embodiment 3: Shake flask fermentation produces enzyme

[0063] The recombinant Bacillus subtilis CCTCC M2016536 / pUB110-TsCDase obtained in Example 2 was inoculated in LB medium, and cultivated at 37°C for 8h to obtain seed liquid; the seed liquid was transferred to 50mL TB with 5% inoculum In the fermentation medium, first place it at 37°C and 200rpm for constant temperature cultivation for 2h to OD 600 After 0.5-0.6, shake the flask to induce fermentation at 33°C and 200rpm for 24 hours to obtain a fermentation broth; centrifuge the fermentation broth to collect the bacteria; centrifuge the bacteria after ultrasonic crushing, and the supernatant is the crude enzyme solution of recombinant TsCDase. The enzyme activity of the crude enzyme solution was determined to be 6.0U / mL. The result of electrophoresis of TsCDase protein shows that the size is 70kDa, which is consistent with the theoretical molecular size (such as Figure 4 shown).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Enzyme activityaaaaaaaaaa
Login to View More

Abstract

The invention discloses application of cyclodextrinase in the preparation of maltoheptaose, and belongs to the technical field of biology. The invention provides a recombinant bacillus subtilis, and the recombinant bacillus subtilis takes bacillus subtilis as a host and expresses cyclodextrinase from a Thermococcus sp. Strain B1001. Recombinant expression is carried out on CDase derived from Thermococcus sp. in food-grade bacillus subtilis, the enzyme activity is 5.9 U / mL, maltoheptaose is produced by applying recombinant CDase, the substrate concentration is 80g / L beta-cyclodextrin, and the conversion rate is as high as 82.33%. The conversion rate and the product purity of CDase under a high substrate concentration are high, the production and processing cost of high-purity maltoheptaosecan be effectively reduced, and the application value and the commercial development significance are very good.

Description

technical field [0001] The invention relates to the application of cyclodextrinase in preparing maltoheptaose, which belongs to the field of biotechnology. Background technique [0002] Straight-chain maltooligosaccharides, also known as maltooligosaccharides, refer to functional oligosaccharides formed by linking 3-10 glucose units through α-1,4 glycosidic bonds, which have good processing adaptability and unique Physiological functions are widely used in food, medicine, feed, cosmetics and other fields in the world, such as fillers, moisturizers, fat substitutes and energy supplies. [0003] There are significant differences in the performance of maltooligosaccharides with different degrees of polymerization. With the increase of the degree of polymerization, the osmotic pressure decreases, the viscosity increases, the moisturizing effect increases, the stability of heat, acid and alkali is enhanced, and the film-forming properties are enhanced. However, oligosaccharides ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P19/04C12P19/14C12N15/75C12N9/42C12R1/125
CPCC12P19/04C12P19/14C12N15/75C12N9/2434C12Y302/01054
Inventor 黄燕吴敬王蕾武权陈晟宿玲恰
Owner JIANGNAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com