Method for assisting whole-cell transformation to synthesize L-asparagine

A whole-cell transformation, asparagine technology, applied in microorganism-based methods, biochemical equipment and methods, microorganisms, etc., can solve problems such as unstable properties, increased difficulty in product separation and purification, and inhibition

Active Publication Date: 2020-10-30
JIANGNAN UNIV
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method production process and equipment are simple, and production efficiency is high, but owing to needing the participation of ATP in the conversion process, but ATP is expensive, and cost is too high, and property is unstable, and can accumulate by-product (AMP or ADP) in synthetic process, Not only increases the difficulty of product separation and purification, but also may cause product inhibition
[0004] Previous attempts to add glucose to a reaction system that only expresses asparagine synthase A whole-cell synthesis, regenerate ATP through the glycolytic pathway, and synthesize L-asparagine, but failed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for assisting whole-cell transformation to synthesize L-asparagine
  • Method for assisting whole-cell transformation to synthesize L-asparagine
  • Method for assisting whole-cell transformation to synthesize L-asparagine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Embodiment 1: Construction of Escherichia coli Rosetta(DE3) / pET21a-DfiPPK2s genetic engineering bacteria

[0025] The Deinococcus ficus genome was extracted using a kit, and using it as a template, primer PPK2s-F (SEQ ID NO.2) (ACAGCAAATGGGTCGGGATCCATGAAAACCGACCGGTACCG, carrying a BamHI restriction site) and primer PPK2s-R (SEQ ID NO.3) (TGGTGGTGCTCGAGTGCGGCCGCGATGCGGACTTCCTTGGGG, carrying NotⅠ restriction site) PCR amplified DfiPPK2s gene. Ligate the amplified gene to the pET21a vector, transform the constructed recombinant plasmid into E.coli BL21(DE3), E.coli Rosetta(DE3) and E.coli RosettatamiB(DE3), pick the transformants, and identify Positive bacteria, obtain recombinant bacteria that can express DfiPPK2s, and compare the effects of different hosts on gene expression, the results are as follows figure 2 As shown, using E.coli Rosetta (DE3) as a host can promote the expression of DfiPPK2s gene.

Embodiment 2

[0026] Example 2: Fermentation of Escherichia coli Rosetta(DE3) / pET21a-Dfi-PPK2s

[0027] Escherichia coli Rosetta(DE3) / pET21a-Dfi-PPK2s was inoculated into LB medium (LB / Amp-Chl) medium supplemented with ampicillin and chloramphenicol at 37°C, cultured at 200rmp overnight, and 2% was inoculated into TB / Amp Grow to OD 600 0.6, add 0.1mM IPTG 16 ℃, 200rmp culture for 24 hours.

Embodiment 3

[0028] Example 3: Conditions for whole cell catalysis of L-aspartic acid to produce L-aspartic acid

[0029] Add 0.1mol·L to the 5mL reaction system -1 Tris-HCl (pH 8.0), 0.1mol L -1 L-Asp, 0.4mol·L -1 NH 4 Cl, 6mmol L -1 ATP, 200mmol·L -1 MgCl 2 , 60mmol·L -1 Sodium hexametaphosphate, 1% Triton X-100, OD 600 Recombinant strain B. subtilis WB600 / pMA5-LsaAS-A and OD expressing asparagine synthetase for 10 600 For the recombinant bacteria expressing class III polyphosphate kinase obtained by fermenting Example 2 of 10, the reaction starts from the addition of ATP, the reaction temperature is 40°C, and the rotation speed is 180rpm. -1 Sodium hexametaphosphate, after 12 hours of reaction, boiled water bath for 5 minutes to terminate the reaction.

[0030] Among them, the recombinant bacteria B.subtilis WB600 / pMA5-LsaAS-A expressing asparagine synthase was previously constructed and preserved in the laboratory, and was published in "Gene Mining and Enzymatic Properties of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
melting pointaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for assisting whole-cell transformation to synthesize L-asparagine, which constructs a system for regenerating ATP by single-enzyme transformation of AMP by utilizingIII-class polyphosphate kinase 2, and applies the system to biosynthesis of L-asparagine. The method comprises the following steps: expressing III-type PPK2 from Deinococcus ficus in Escherichia coliRosetta (DE3), wherein the enzyme activity of the III-type PPK2 is 13.19 U.mL <-1 >, and the enzyme activity of the III-type PPK2 from Deinococcus ficus is 13.19 U.mL<-1>. E. Coli Rosetta (DE3) / pET21a-DfiPPK2-III and B. Subtilius WB600 / pMA5-LsaAS-A whole cells are used as catalysts to catalyze L-Asp to synthesize L-Asn, and the reaction conditions are optimized. Results show that the yield of L-Asn reaches 90.15%, which is 80% higher than that of sodium hexametaphosphate directly added with 180mmol. L<-1>, by supplementing sodium hexametaphosphate with the final concentration of 60mmol. L <-1>twice to wet cells of the two recombinant bacteria under optimal reaction conditions.

Description

technical field [0001] The invention relates to a method for assisting whole cells to transform and synthesize L-asparagine, which belongs to the technical field of biotransformation. Background technique [0002] L-Asparagine is also known as 2-amino-3-carbamoylpropionic acid in Chinese. It is white orthorhombic crystal or crystalline powder with a slightly sweet taste and a melting point of about 234°C. Soluble in water, almost insoluble in ethanol and ether, the aqueous solution is acidic. In case of alkali, it will be hydrolyzed into aspartic acid. Its aqueous solution is easily decomposed by heating. Aspartic acid is used in food, medicine, chemical industry and biology [0003] The preparation methods of asparagine include direct extraction method, chemical synthesis method and biosynthesis method. The direct extraction method is mainly based on white lupine. After germination, pulping, heating and other treatment processes, under the condition of pH not greater t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P13/20C12P39/00C12R1/125C12R1/19
CPCC12P13/20C12P39/00
Inventor罗玮许景龙
OwnerJIANGNAN UNIV