Unlock instant, AI-driven research and patent intelligence for your innovation.

shRNA capable of inhibiting M gene expression of porcine epidemic diarrhea virus

A technology of gene expression and lentivirus, applied in the field of shRNA, can solve the problems of rapid proliferation, difficulty in epidemic prevention, and many mutations of diarrhea virus, and achieve the effect of inhibiting replication and broad application prospects

Inactive Publication Date: 2020-12-11
ARMY MEDICAL UNIV
View PDF14 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to solve the technical problems in the prior art that porcine epidemic diarrhea virus has many variations, rapid proliferation and difficult epidemic prevention

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • shRNA capable of inhibiting M gene expression of porcine epidemic diarrhea virus
  • shRNA capable of inhibiting M gene expression of porcine epidemic diarrhea virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1 contains the acquisition of suppressing porcine epidemic diarrhea virus shRNA

[0033] Selected 234 representative PEDV strains from the 360 ​​PEDV strains provided by NCBI with full genome RNA sequences, and intercepted the coding sequences of their E, M, N genes one by one to obtain "E, M, N gene fragments", Using AlignX to compare these "E, M, N gene fragments", we found that there are relatively many long fragments of conserved sequences in the M gene and N gene, and the longest conserved sequence fragment can reach 38bp. Furthermore, the target sequence GCCAAGGCCACTACAACAATT for the M gene is preferably obtained among the alternative target sequences. Then carry out shRNA design and artificially synthesize interference fragments. It has been verified to have a coverage of 99.7% among all strains.

[0034] The DNA sequence of the interfering sequence that suppresses porcine epidemic diarrhea virus of the present invention is:

[0035] Justice Chain: ...

Embodiment 2

[0046] Embodiment 2 contains the preparation of the Vero E6 cell that suppresses porcine epidemic diarrhea virus shRNA

[0047] Main reagents: Escherichia coli strain DH5α, restriction enzymes XhoI and EcoRI, T4 ligase, plasmid DNA extraction kit, gel recovery kit, agarose, agar powder, DNA ladder, DMEM+10% FBS, Trypsin-EDTASolution (0.25% Trypsin-EDTA, Gibco), cell culture plate, DEPC-treated tip and EP tube, TrizolReagent, isopropanol (analytical grade), chloroform (analytical grade), DEPC-H2O, Reverse Transcriptase, QPCR mix.

[0048] (1) Cell culture

[0049] Cells were grown in high-glucose DMEM cell culture medium containing 10% fetal bovine serum and 1% double antibody at 37°C, 5% CO 2 cultured in an incubator. When the cell growth density reached 90%, subculture was carried out according to the ratio of 1:3.

[0050] (2) Construction of stable cell lines

[0051] Cells and plasmids: Vero-E6 cells, interference vector pPRIME-CMV-Neo-PEDV-shRNA-M

[0052] Experimen...

Embodiment 3

[0060] Embodiment 3 The experiment of shRNA anti-PEDV infection and replication of the present invention

[0061] 1. Inhibition of PEDV replication on Vero-E6 cells stably transfected with shRNA

[0062] Cells and viruses: Vero-E6 cells stably transfected with shRNA plasmids, classic porcine epidemic diarrhea virus strain CV777 (the stock strain of the Animal Science and Technology College of China Agricultural University).

[0063] Main reagents: high glucose DMEM, special grade fetal bovine serum, trypsin, double antibodies (penicillin, streptomycin), PrimeScript TM RT reagent Kit with gDNA Eraser (Dalian Bao Biotechnology Co., Ltd.)

[0064] (1) PEDV vaccination

[0065] The stable cell line and normal Vero-E6 cells were inoculated with CV777 at MOI=1. Cell changes were observed 48h after inoculation.

[0066] (2) Real-time quantitative PCR test detects viral mRNA expression

[0067] Total cellular RNA was extracted by TRIzol lysis method. Add 1mL TRIzol to the six-ho...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and specifically relates to shRNA capable of inhibiting M gene expression of a porcine epidemic diarrhea virus. The technical problems to be solved are multi-mutation, fast proliferation and difficult epidemic prevention of the porcine epidemic diarrhea virus. The technical scheme able to solve the above problems is to provide the shRNA forinhibiting PEDV replication. The target sequence that the shRNA aims at is 5'-GCCAAGGCCACTACAACAATT-3'. The shRNA can significantly inhibit M gene expression so as to prevent the replication of PEDV virus, so that the shRNA has wide application prospects.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an shRNA used for inhibiting the expression of PEDV M gene. Background technique [0002] Porcine epidemic diarrhea (PED), caused by porcine epidemic diarrhea virus (PEDV), is a devastating disease characterized by acute enteritis, vomiting, and severe watery diarrhea, and is highly contagious. Bring huge threat and huge economic loss to global live pig industry. The M gene of PEDV is highly conserved among various strains, with a full length of 681bp and a molecular weight of 27ku-32ku. As the surface structural protein of viruses, it plays a very important function in the process of virus assembly. Studies have shown that M protein can interact with M protein itself, N protein and S protein. In cells infected with PEDV, the M gene of the virus is highly expressed and plays a very important role in the replication of the virus. [0003] RNA interference plays a very ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/867C12N7/01A61K31/713A61P31/14
CPCC12N15/1131C12N15/86C12N7/00A61K31/713A61P31/14C12N2310/14C12N2310/531C12N2740/15043C12N2740/15021
Inventor 王勇魏泓李瑶王首奇罗力华
Owner ARMY MEDICAL UNIV