shRNA capable of inhibiting M gene expression of porcine epidemic diarrhea virus
A technology of gene expression and lentivirus, applied in the field of shRNA, can solve the problems of rapid proliferation, difficulty in epidemic prevention, and many mutations of diarrhea virus, and achieve the effect of inhibiting replication and broad application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Embodiment 1 contains the acquisition of suppressing porcine epidemic diarrhea virus shRNA
[0033] Selected 234 representative PEDV strains from the 360 PEDV strains provided by NCBI with full genome RNA sequences, and intercepted the coding sequences of their E, M, N genes one by one to obtain "E, M, N gene fragments", Using AlignX to compare these "E, M, N gene fragments", we found that there are relatively many long fragments of conserved sequences in the M gene and N gene, and the longest conserved sequence fragment can reach 38bp. Furthermore, the target sequence GCCAAGGCCACTACAACAATT for the M gene is preferably obtained among the alternative target sequences. Then carry out shRNA design and artificially synthesize interference fragments. It has been verified to have a coverage of 99.7% among all strains.
[0034] The DNA sequence of the interfering sequence that suppresses porcine epidemic diarrhea virus of the present invention is:
[0035] Justice Chain: ...
Embodiment 2
[0046] Embodiment 2 contains the preparation of the Vero E6 cell that suppresses porcine epidemic diarrhea virus shRNA
[0047] Main reagents: Escherichia coli strain DH5α, restriction enzymes XhoI and EcoRI, T4 ligase, plasmid DNA extraction kit, gel recovery kit, agarose, agar powder, DNA ladder, DMEM+10% FBS, Trypsin-EDTASolution (0.25% Trypsin-EDTA, Gibco), cell culture plate, DEPC-treated tip and EP tube, TrizolReagent, isopropanol (analytical grade), chloroform (analytical grade), DEPC-H2O, Reverse Transcriptase, QPCR mix.
[0048] (1) Cell culture
[0049] Cells were grown in high-glucose DMEM cell culture medium containing 10% fetal bovine serum and 1% double antibody at 37°C, 5% CO 2 cultured in an incubator. When the cell growth density reached 90%, subculture was carried out according to the ratio of 1:3.
[0050] (2) Construction of stable cell lines
[0051] Cells and plasmids: Vero-E6 cells, interference vector pPRIME-CMV-Neo-PEDV-shRNA-M
[0052] Experimen...
Embodiment 3
[0060] Embodiment 3 The experiment of shRNA anti-PEDV infection and replication of the present invention
[0061] 1. Inhibition of PEDV replication on Vero-E6 cells stably transfected with shRNA
[0062] Cells and viruses: Vero-E6 cells stably transfected with shRNA plasmids, classic porcine epidemic diarrhea virus strain CV777 (the stock strain of the Animal Science and Technology College of China Agricultural University).
[0063] Main reagents: high glucose DMEM, special grade fetal bovine serum, trypsin, double antibodies (penicillin, streptomycin), PrimeScript TM RT reagent Kit with gDNA Eraser (Dalian Bao Biotechnology Co., Ltd.)
[0064] (1) PEDV vaccination
[0065] The stable cell line and normal Vero-E6 cells were inoculated with CV777 at MOI=1. Cell changes were observed 48h after inoculation.
[0066] (2) Real-time quantitative PCR test detects viral mRNA expression
[0067] Total cellular RNA was extracted by TRIzol lysis method. Add 1mL TRIzol to the six-ho...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

