Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Transaminase mutant and application thereof in preparation of sitagliptin intermediate

A technology of mutants and transaminases, applied in the field of recombinant genetically engineered bacteria and recombinant enzymes, can solve the problems of poor stereoselectivity, difficult solvent recovery, and low production costs

Active Publication Date: 2021-03-19
ZHEJIANG UNIV OF TECH +2
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The present invention aims at the defects (poor stereoselectivity, expensive catalyst, difficult recovery of solvent, etc.) existing in the existing production process of sitagliptin intermediate, and provides a transaminase mutant, coding gene, recombinant carrier, recombinant Genetically engineered bacteria, and the application of asymmetric transamination to obtain sitagliptin or sitagliptin ester intermediates, the method has high conversion rate of raw materials, low production cost and high yield

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transaminase mutant and application thereof in preparation of sitagliptin intermediate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1: Amplification of transaminase gene MbTA

[0029] According to the transaminase gene sequencing information from Mycolicibacterium included in Genbank, the total genomic DNA of the transaminase of Mycolicibacterium was extracted with a rapid nucleic acid extraction instrument, and the genomic DNA was used as a template, and primer 1 (ATGGGCATCGATACC), primer 2 (GTAGCAGATATCTTCGA) for PCR amplification. PCR reaction system (total volume 50 μL): 5 μL of 10×Pfu DNA Polymerase Buffer, 1 μL of 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP and dTTP), 1 μL of cloning primer 1 and primer 2 each at a concentration of 50 μM, 1 μL of genomic DNA , Pfu DNA Polymerase 1μL, nucleic acid-free water 40μL.

[0030] Using BioRad PCR instrument, PCR reaction conditions: pre-denaturation at 95°C for 5min, denaturation at 95°C for 30s, annealing at 65°C for 45s, extension at 72°C for 1min, a total of 30 cycles, and finally extension at 72°C for 10min.

[0031] The PCR reac...

Embodiment 2

[0032] Embodiment 2: Construction of recombinant Escherichia coli BL21 / pET28b-MbTA

[0033] Primer 3 (CCG) was designed according to the MbTA gene sequence in Example 1 GAATTC GGTATCGACACCGGTACCTC), primer 4 (TTGGG ATCCGT ACTGGATAGCTTCGATCAGC)), and EcoR I and BamH I restriction enzyme sites (underlined) were introduced into primer 3 and primer 4, respectively. Under the initiation of primer 3 and primer 4, high-fidelity Pfu DNA polymerase was used to amplify, and the recombinant plasmid pMD18-T-MbTA was used as a template (obtained in Example 1) to obtain the MbTA gene sequence. After sequencing, EcoR I and The amplified fragment was treated with BamH I restriction endonuclease (TaKaRa), and the fragment was ligated with the commercial vector pET28b (Invitrogen) treated with the same restriction endonuclease using T4 DNA ligase (TaKaRa) to construct Expression vector pET28b-MbTA. The constructed expression vector pET28b-MbTA was transformed into Escherichia coli BL21(DE3...

Embodiment 3

[0034] Example 3: Induced expression of aminotransferase (MbTA)

[0035] The recombinant Escherichia coli BL21(DE3) / pET28b-MbTA obtained in Example 2 was inoculated into LB liquid medium containing 50 μg / ml kanamycin resistance, cultivated at 37° C. for 12 hours at 200 rpm, and then treated with 1% (v / v) The inoculum is inoculated into fresh LB liquid medium containing 50 μg / ml kanamycin resistance, cultured at 37°C and 150 rpm until the OD 600 of the bacteria reaches 0.6-0.8, and the final concentration of 0.1 mM IPTG is added After induction culture at 28°C for 12h, centrifuge at 5000rpm at 4°C for 25min, discard the supernatant, collect the precipitate, and obtain the recombinant Escherichia coli BL21 / pET28b-MbTA wet cell containing the expression recombinant plasmid. The bacterium can be used directly as a biocatalyst or for protein purification.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a transaminase mutant and application thereof in preparation of sitagliptin intermediate. The transaminase mutant is prepared by substituting tyrosine at locus 74 with proline,glutamic acid at locus 228 with aspartic acid, leucine at locus 254 with alanine and methionine at locus 290 with threonine in an amino acid sequence shown as SEQ ID NO: 2. According to the application of the transaminase mutant in the preparation of the sitagliptin intermediate, the sitagliptin intermediate is prepared by a method which takes wet thallus or pure enzyme obtained by fermenting andculturing engineering bacteria containing transaminase mutant encoding genes as a biocatalyst, as well as a sitagliptin intermediate precursor ketone or a prochiral carbonyl compound as a substrate.The total yield of the method is about 82%; and the e.e. value of the product can be up to 99%.

Description

[0001] (1) Technical field [0002] The present invention relates to the field of biochemical technology, specifically, a method for preparing an optically pure sitagliptin intermediate of transaminase and its mutant enzyme, including transaminase, mutant, coding gene, recombinant vector containing the gene, the Recombinant genetically engineered bacteria and recombinase obtained by transformation of the recombinant vector, and applications. [0003] (2) Background technology [0004] Sitagliptin (sitagliptin) was researched and developed by American Merck Company and Codexis Company. It is the first dipeptidyl peptidase-IV (DPP-IV) inhibitor approved by FDA for the treatment of type Ⅱ diabetes. Sitagliptin can increase the secretion of insulin in a blood glucose-dependent manner, and has a relatively moderate hypoglycemic effect, without causing hypoglycemia, and without side effects such as weight gain, nausea, and vomiting. The trade name of sitagliptin is Januvia, which ha...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/10C12N15/54C12N1/21C12P41/00C12P17/12C12P13/00C12R1/19
CPCC12N9/1096C12P41/006C12P17/12C12P13/001C12Y206/01C12N1/20C12N15/70C12N2800/101C12P17/182C12Y206/01018
Inventor 柳志强程峰张晓健贾东旭郑裕国何人宝金逸中邵鸿鸣林娇华张峰
Owner ZHEJIANG UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com