Engineering bacterium for producing inositol as well as construction method and application of engineering bacterium

A technology for producing myo-inositol and a method for constructing it is applied in the field of engineering bacteria for producing myo-inositol and its construction, which can solve the problems of high preparation or purchase cost, low yield, and inability to compete with natural myo-inositol, so as to accelerate the utilization of glycerol and realize rapid Growth, the effect of realizing the efficient production of inositol

Active Publication Date: 2021-04-13
BEIJING UNIV OF CHEM TECH
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the production method of inositol is mainly chemical synthesis method, but the chemical synthesis process is complicated, the cost is high, the pollution is serious, and it cannot compete with natural inositol, and industrial trials have not been carried out.
In recent years, enzymatic hydrolysis has become a research hotspot. Enzymatic hydrolysis is new and efficient, with normal temperature and pressure, and no pollution. However, it is difficult to purify the enzyme, the cost of preparation or purchase is high, and the yield is low.
Hydrolysis, chemical synthesis, and enzymatic hydrolysis all have problems such as high cost, high pollution, and low yield to varying degrees.
Therefore, although inositol has a wide range of applications, it has not been widely used due to its high price and supply problems. Therefore, it is imminent to develop a new method for producing inositol with low cost, no pollution and high yield.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacterium for producing inositol as well as construction method and application of engineering bacterium
  • Engineering bacterium for producing inositol as well as construction method and application of engineering bacterium
  • Engineering bacterium for producing inositol as well as construction method and application of engineering bacterium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] De novo synthesis of inositol from simple carbon sources such as sucrose, glucose, and glycerol

[0038] Through NCBI (https: / / blast.ncbi.nlm.nih.gov) sequence alignment analysis and comparison of enzyme activities reported in the literature, screen inositol-1-phosphate derived from bacteria, fungi or protein engineering Inositol is catalyzed by synthetase (INO1) and inositol monophosphatase (suhB) in two steps. First, the gene fragments of inositol-1-phosphate synthase (INO1) and inositol monophosphatase (suhB) were obtained by PCR amplification technology, the target gene after gel electrophoresis was gel recovered, and the target gene was extracted by double enzyme digestion Simultaneous enzyme digestion with the plasmid vector, after gel recovery, connect the vector and the fragment at 22°C for 1 hour, transform into Escherichia coli Trans5α or Trans10, recover at 30-37°C for 45min-1h, spread, and culture overnight until the strain grows up, pick Three parallel str...

Embodiment 2

[0042] Improving Inositol Production Using RED Homologous Recombination Gene Regulatory Strategy

[0043] Such as figure 1 As shown, in the production pathway of inositol, glucose-6-phosphate is an effective precursor for the synthesis of inositol, and inositol-1-phosphate synthase (INO1) can convert glucose-6-phosphate into inositol-1- Phosphate, inositol-1-phosphate, is then converted to inositol by inositol monophosphatase (suhB). In order to increase the supply of precursor glucose-6-phosphate, on the basis of the host strain BW25113, the gene zwf encoding glucose-6-phosphate dehydrogenase in the pentose phosphate pathway and the gene encoding glucose-6-phosphate dehydrogenase in the glycolysis pathway were knocked out. pgi of the enzyme gene, galU of the gene encoding glucose-1-phosphate uridine acyltransferase, and glgC of the gene encoding glucose-1-phosphate adenylyltransferase, and because the intermediate phosphoenolpyruvate (PEP) will It is converted into pyruvate...

Embodiment 3

[0053] Replace the lac promoter with a constitutive promoter to increase yield

[0054] Through the sequence alignment analysis of Promoters (http: / / parts.igem.org), five different constitutive promoters were screened and transformed. The gene sequences of the constitutive promoters are as follows:

[0055] SEQ ID NO: 1 ttgacaattaatcatcggctcgtataatgt;

[0056] SEQ ID NO: 2 tttacggctagctcagtcctaggtacaatgctagc;

[0057] SEQ ID NO: 3 tttacagctagctcagtcctagttattatgctagc;

[0058] SEQ ID NO: 4 ttgacggctagctcagtcctagtacagtgctagc;

[0059] SEQ ID NO: 5 tttatggctagctcagtcctagtacaatgctagc.

[0060] Firstly, PCR amplification technology was used to obtain gene fragments containing different promoters, and the target gene after gel electrophoresis was gel-recovered, and the target gene containing the promoter and the plasmid vector were digested simultaneously by double enzyme digestion, and the gel was recovered at 22°C Ligate the vector with the fragment for 1 h, transform into Esc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an engineering bacterium for producing inositol. The engineering bacterium comprises a host bacterium and a plasmid vector transferred into the host bacterium; a gene for encoding inositol-1-phosphate synthase is introduced into the plasmid vector, or a gene for encoding inositol-1-phosphate synthase and a gene for overexpressing and encoding inositol monophosphase are introduced into the plasmid vector at the same time. The invention also provides a construction method and application of the engineering bacterium for producing inositol. According to the engineering bacterium, endogenous enzyme is overexpressed while the exogenous enzyme is utilized, gene regulation and control are conducted in combination with RED recombination, the yield of inositol and the yield of a carbon source are increased step by step, and therefore rapid growth of a host and efficient production of inositol are achieved with sucrose, glucose, glycerol and other simple carbon sources as sources and through mutual coordination of production and growth.

Description

technical field [0001] The invention relates to the technical field of bioengineering, in particular to an engineering bacterium for producing inositol and its construction method and application. Background technique [0002] Inositol, also known as cyclohexyl alcohol, inositol, inositol, etc., mainly exists in animals and plants, is a growth factor for animals and microorganisms, and is also a water-soluble vitamin B group. Inositol is widely used, mainly in feed, food, medicine, cosmetics and other industries. In the feed industry, inositol, as a feed additive, has a huge demand in animal husbandry, aquaculture, and poultry breeding, and its addition is generally 0.2% to 0.5% of the feed. It is above 100t; experiments have shown that lack of inositol in higher animals will cause symptoms such as hair loss and growth stagnation, and adding inositol can prevent hair loss and promote growth. In the food industry, inositol is used as a nutritional enhancer in the food indus...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/55C12N15/61C12N15/70C12P7/18C12R1/19
CPCC12N9/90C12N9/16C12N9/1205C12N15/70C12P7/18C12Y505/01C12Y207/0103
Inventor袁其朋孙新晓唐二菊
OwnerBEIJING UNIV OF CHEM TECH