Difunctional sesterterpene/diterpene synthase LcTPS2, coding gene, product thereof and application of difunctional sesterterpene/diterpene synthase LcTPS2
A technology of disesquiterpene and diterpene synthase, applied in the fields of synthetic biology and natural medicinal chemistry, can solve the problem that anti-inflammatory and immunosuppressive activities are not reported in literature and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0034] The present invention also provides a method for preparing a fermented liquid containing 14- / 18-membered macrocyclic terpenoids, comprising the following steps:
[0035] A recombinant vector containing the above coding gene is constructed, the recombinant vector is transformed into Escherichia coli or Saccharomyces cerevisiae, and the fermentation broth is obtained after fermentation. In the present invention, the basic vector of the recombinant vector is not particularly limited, and the basic vector in the embodiment of the present invention is preferably pCold TF. In the present invention, the species of Escherichia coli or Saccharomyces cerevisiae is not particularly limited. In the embodiments of the present invention, Escherichia coli is preferably strain Rosetta (DE3) or Escherichia coli BL21 (DE3) strain. The present invention has no special limitations on the methods for constructing the recombinant vector and transformation, and conventional methods in the art...
Embodiment 1
[0047] Acquisition and bioinformatics analysis of the cDNA sequence of the gene encoding the bifunctional sesquiterpene / diterpene synthase LcTPS2:
[0048] According to the Molecular Cloning Handbook, RNA was obtained from Oryza sativa, using SMART TM The primers 5'-CDS primer, SMART IITM A oligonucleotide, and 3'-CDS primer in the RACE cDNA AmplificationKit kit were reverse-transcribed to synthesize cDNA, and the specific primer pairs LcTPS2-3race-out, LcTPS2-3race-in and LcTPS2-5race-out and LcTPS2-5race-in were used as primers for PCR amplification, and the amplified products were subjected to agarose gel electrophoresis to obtain attached figure 1 , the amplified product was recovered and purified to obtain the full-length cDNA sequence of the LcTPS2 gene.
[0049] Primer sequence Numbering LcTPS2-3race-out TCCGCAATGAAGGAAGACTTTGAATGGCTAA SEQ ID NO.3 LcTPS2-3race-in GTTATGAGGTTGAGAAGGAGAGGG SEQ ID NO.4 LcTPS2-5race-out CCCCTCTCCTTCTC...
Embodiment 2
[0052] Construction of gene expression vector encoding bifunctional sesquiterpene / diterpene synthase LcTPS2:
[0053] Using the LcTPS2 gene cDNA synthesized in Example 1 as a template, LcTPS2F: 5'-GGTACCATGGCTGCTCCAATCTCTGCAAACC-3' (SEQ ID NO.7) and LcTPS2R: 5'-CTGCAGCTAAATCTTAATTTGATCGATGAAC-3' (SEQ ID NO.8) as forward and reverse primers, Use the high-fidelity enzyme PrimeSTAR HS DNA Polymerase for PCR amplification, and the PCR system is 50 μL.
[0054] The PCR amplification reaction system is:
[0055] 5×PrimeSTAR HS Buffer 10μL dNTP Mixture (2.5mM each) 4μL Primer F 1μL Primer R 1μL Template cDNA 0.5μL PrimeSTAR HS DNA Polymerase 0.5μL Deionized water 33μL
[0056] The reaction program of PCR amplification is: 98°C 10sec, 60°C 15sec, 72°C 2min, 35 cycles. After the procedure, product recovery and purification were carried out.
[0057] Both the purified product and the pCold TF vector were double-digested with r...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 



