Difunctional sesterterpene/diterpene synthase LcTPS2, coding gene, product thereof and application of difunctional sesterterpene/diterpene synthase LcTPS2

A technology of disesquiterpene and diterpene synthase, applied in the fields of synthetic biology and natural medicinal chemistry, can solve the problem that anti-inflammatory and immunosuppressive activities are not reported in literature and the like

Active Publication Date: 2021-07-30
KUNMING INST OF BOTANY - CHINESE ACAD OF SCI
View PDF9 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, no natural 14- / 18-membered ring sesquiterpene has been isolated from any organism, and the terpene synthase encoding gene responsible for cyclization of 14- / 18-membered ring sesquiterpene and its application have not been reported yet. Anti-inflammatory and immunosuppressive activities have also not been reported in the literature

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Difunctional sesterterpene/diterpene synthase LcTPS2, coding gene, product thereof and application of difunctional sesterterpene/diterpene synthase LcTPS2
  • Difunctional sesterterpene/diterpene synthase LcTPS2, coding gene, product thereof and application of difunctional sesterterpene/diterpene synthase LcTPS2
  • Difunctional sesterterpene/diterpene synthase LcTPS2, coding gene, product thereof and application of difunctional sesterterpene/diterpene synthase LcTPS2

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0034] The present invention also provides a method for preparing a fermented liquid containing 14- / 18-membered macrocyclic terpenoids, comprising the following steps:

[0035] A recombinant vector containing the above coding gene is constructed, the recombinant vector is transformed into Escherichia coli or Saccharomyces cerevisiae, and the fermentation broth is obtained after fermentation. In the present invention, the basic vector of the recombinant vector is not particularly limited, and the basic vector in the embodiment of the present invention is preferably pCold TF. In the present invention, the species of Escherichia coli or Saccharomyces cerevisiae is not particularly limited. In the embodiments of the present invention, Escherichia coli is preferably strain Rosetta (DE3) or Escherichia coli BL21 (DE3) strain. The present invention has no special limitations on the methods for constructing the recombinant vector and transformation, and conventional methods in the art...

Embodiment 1

[0047] Acquisition and bioinformatics analysis of the cDNA sequence of the gene encoding the bifunctional sesquiterpene / diterpene synthase LcTPS2:

[0048] According to the Molecular Cloning Handbook, RNA was obtained from Oryza sativa, using SMART TM The primers 5'-CDS primer, SMART IITM A oligonucleotide, and 3'-CDS primer in the RACE cDNA AmplificationKit kit were reverse-transcribed to synthesize cDNA, and the specific primer pairs LcTPS2-3race-out, LcTPS2-3race-in and LcTPS2-5race-out and LcTPS2-5race-in were used as primers for PCR amplification, and the amplified products were subjected to agarose gel electrophoresis to obtain attached figure 1 , the amplified product was recovered and purified to obtain the full-length cDNA sequence of the LcTPS2 gene.

[0049] Primer sequence Numbering LcTPS2-3race-out TCCGCAATGAAGGAAGACTTTGAATGGCTAA SEQ ID NO.3 LcTPS2-3race-in GTTATGAGGTTGAGAAGGAGAGGG SEQ ID NO.4 LcTPS2-5race-out CCCCTCTCCTTCTC...

Embodiment 2

[0052] Construction of gene expression vector encoding bifunctional sesquiterpene / diterpene synthase LcTPS2:

[0053] Using the LcTPS2 gene cDNA synthesized in Example 1 as a template, LcTPS2F: 5'-GGTACCATGGCTGCTCCAATCTCTGCAAACC-3' (SEQ ID NO.7) and LcTPS2R: 5'-CTGCAGCTAAATCTTAATTTGATCGATGAAC-3' (SEQ ID NO.8) as forward and reverse primers, Use the high-fidelity enzyme PrimeSTAR HS DNA Polymerase for PCR amplification, and the PCR system is 50 μL.

[0054] The PCR amplification reaction system is:

[0055] 5×PrimeSTAR HS Buffer 10μL dNTP Mixture (2.5mM each) 4μL Primer F 1μL Primer R 1μL Template cDNA 0.5μL PrimeSTAR HS DNA Polymerase 0.5μL Deionized water 33μL

[0056] The reaction program of PCR amplification is: 98°C 10sec, 60°C 15sec, 72°C 2min, 35 cycles. After the procedure, product recovery and purification were carried out.

[0057] Both the purified product and the pCold TF vector were double-digested with r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention provides a difunctional sesterterpene / diterpene synthase LcTPS2, a coding gene and application thereof, and relates to the technical field of synthetic biology and natural pharmaceutical chemistry. According to the invention, a terpene synthase LcTPS2 coding gene for synthesizing a 14- / 18-membered ring terpene compound is cloned and functionally identified from labiatae plant Ipomoea cairica, and the nucleotide sequence of the terpene synthase LcTPS2 coding gene is as shown in SEQ ID NO.2. The genetically engineered cell constructed by the invention is safe and stable and short in production cycle, and the synthesized macrocyclic sesterterpene product has anti-inflammatory and immunosuppressive activity, and has an obvious inhibiting effect on inducing a Jurkat cell line to secrete IL-2 by combining phytohemagglutinin with 12-phorboester-13-acetate and stimulating mouse T cells to generate cell factors IFN-gamma by CD3 and CD28 monoclonal antibodies. However, the compound has no obvious cytotoxicity to Jurkat and splenocytes.

Description

technical field [0001] The invention relates to the technical fields of synthetic biology and natural medicinal chemistry, in particular to a bifunctional sesquiterpene / diterpene synthase LcTPS2, an encoding gene and its product and application. Background technique [0002] Terpenoids are a class of natural products with the largest variety and the most abundant chemical structure changes. They are widely found in higher plants and microorganisms and have important economic and medicinal values. Macrocyclic terpenoids containing 12-membered rings and above are a class of terpenoid natural products with unique structures, which usually have significant defense functions as well as anti-cancer, anti-leukemia, anti-inflammatory and antibacterial activities. [0003] In recent years, researchers have used functional genomics and metabolomics techniques to conduct in-depth studies on the synthetic pathways of different terpenoids, providing a large amount of data support for the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/88C12N15/60C12N15/70C12N15/81C12N15/84C12P5/00C12P7/02A01H5/00A01H6/82A61K31/015A61K31/045A61P29/00A61P37/06C12R1/19C12R1/865
CPCC12N9/88C12N15/70C12N15/81C12N15/8243C12P5/007C12P7/02A61K31/015A61K31/045A61P29/00A61P37/06Y02A50/30
Inventor 黎胜红刘燕陈月桂凌伊刘艳春
Owner KUNMING INST OF BOTANY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap