Recombinant bacillus subtilis with high yield of N-acetylneuraminic acid, and construction method and application of recombinant bacillus subtilis

A technology of Bacillus subtilis and acetylneuraminic acid, which is applied in the field of bioengineering, can solve problems such as safety issues, and achieve the effects of no endotoxin, environmental friendliness, and simple production process

Pending Publication Date: 2021-08-13
ZHEJIANG UNIV OF TECH
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, Escherichia coli is mainly used as the host at present, and Escherichia coli itself is an opportunistic pathogen. Its products may have safety problems when used in the food field, especially in infant food

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant bacillus subtilis with high yield of N-acetylneuraminic acid, and construction method and application of recombinant bacillus subtilis
  • Recombinant bacillus subtilis with high yield of N-acetylneuraminic acid, and construction method and application of recombinant bacillus subtilis
  • Recombinant bacillus subtilis with high yield of N-acetylneuraminic acid, and construction method and application of recombinant bacillus subtilis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: Construction of recombinant strain Bs-neuBC expressing neuBC gene on the genome

[0039] 1. The neuBC gene integration plasmid pJOE8999-gRNA-L-P grac - Construction of neuBC-R

[0040] 1) Synthesize the neuBC gene according to the neuBC gene sequence (GenBank No.AF100048), and add BamHI and XbaI sites at both ends;

[0041] 2) Digest the synthesized gene fragment with BamHI and XbaI, and recover it for later use;

[0042] 3) The expression plasmid pHT01 was extracted, digested with BamHI and XbaI, and recovered for later use;

[0043] 4) Ligate the above-mentioned enzyme-cut and purified vectors and fragments, connect them with T4DNA ligase, and transfer them into Escherichia coli DH5α competent cells to obtain the expression vector pHT01-neuBC;

[0044] 5) Enter the amyE amylase gene sequence into the website http: / / chopchop.cbu.uib.no / , and calculate the best gRNA sequence, which is TGAAGATCAGGCTATCACTG (SEQ ID NO.5);

[0045] 6) Using the total DNA of ...

Embodiment 2

[0058] Embodiment 2: Construction of glmS gene expression vector

[0059] 1) Design primers according to the glmS gene in the total DNA gene sequence of E.coli and its upstream and downstream sequences, and the forward primer is F-BamHI-glmS: GGATCC ATGTGTGGAATTGTTGGCGCG (SEQ ID NO.17) and reverse primer R-XbaI-glmS: TCTAGA TTACTCAACCGTAACCGATTTTGCCAGGT (SEQ ID NO.18), a BamHI restriction site is added before the forward primer, and an XbaI restriction site is added before the reverse primer;

[0060] 2) Using the total DNA of E.coli as a template, the glmS fragment (SEQ ID NO.19) was obtained by PCR amplification with the above primers (shown in SEQ ID NO.17-18);

[0061] 3) The plasmid pHT01 and glmS fragments were digested with BamHI and XbaI, recovered and ligated with T4DNA ligase, and transformed into E. coli DH5α competent cells to obtain the expression vector pHT01-glmS.

Embodiment 3

[0062] Embodiment 3: the construction of glmM gene expression vector

[0063] 1) Design primers according to the glmS gene in the total DNA gene sequence of B. subtilis and its upstream and downstream sequences, and the forward primer is F-BamHI-glmM: GGATCC ATGGGCAAGTATTTTGGAACAGACGGTGTA A (SEQ ID NO. 20) and reverse primer R-XbaI-glmM: TCTAGA TTACTCTAATCCCATTTCTGAC CGGA (SEQ ID NO.21), a BamHI restriction site is added before the forward primer, and an XbaI restriction site is added before the reverse primer;

[0064] 2) Using the total DNA of B. subtilis as a template, the glmM (SEQ ID NO.22) fragment was obtained by PCR amplification with the above primers (shown in SEQ ID NO.20-21);

[0065] 3) The plasmid pHT01 and glmM fragments were digested with BamHI and XbaI, recovered and ligated with T4DNA ligase, and transformed into E. coli DH5α competent cells to obtain the expression vector pHT01-glmM.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of bioengineering, in particular to recombinant bacillus subtilis with high yield of N-acetylneuraminic acid, and a construction method and application of the recombinant bacillus subtilis. According to the recombinant bacillus subtilis with high yield of N-acetylneuraminic acid, bacillus subtilis is taken as an expression host; an N-acetylneuraminic acid synthetase gene neuB and an N-acetylglucosamine 2-epimerase gene neuC are integrated onto a bacillus subtilis genome to be stably expressed; and then overexpression on a glucosamine phosphate mutase gene glmM and a fructose 6-phosphate transaminase gene glmS is carried out on a plasmid. According to the invention, a gene engineering technology is adopted to modify the B.subtilis so as to directly synthesize the N-acetylneuraminic acid by using glycerol as the substrate; the production process is simple; environmental protection and no endotoxin are provided; and the method can be used in the food field, and has industrial production value.

Description

technical field [0001] The invention relates to the technical field of bioengineering, in particular to a recombinant bacillus subtilis capable of high-yielding N-acetylneuraminic acid and its construction method and application. Background technique [0002] Sialic acid (SA) is a class of acidic amino sugars containing 9 carbon atoms and a pyranose structure, also known as neuraminic acid, which widely exists in plants, animals and microorganisms, and there are many kinds. There are more than 50 kinds, including N-acetylneuraminic acid (Neu5Ac), N-glycylneuraminic acid (Neu5Gc) and deaminoneuraminic acid (KDN); and N-acetylneuraminic acid (Neu5Ac) is one of them The most important type of sialic acid, which accounts for more than 99% of the sialic acid family, is the precursor for the synthesis of other sialic acids. It is usually located at the end of the sugar chain on the surface of the cell membrane and participates in various physiological functions. [0003] At prese...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/75C12P19/26C12R1/125
CPCC12N9/1085C12N9/2402C12N9/1096C12N9/90C12N15/75C12P19/26C12Y205/01056C12Y302/01183C12Y206/01016C12Y504/0201
Inventor竹国津柳鹏福储消和陈艳郭倩韩笑笑
OwnerZHEJIANG UNIV OF TECH