Nanometer antibody aiming at green fluorescent protein (GFP) and application thereof

A technology of green fluorescent protein and nano-antibody, which is applied in the field of genetic engineering antibody and single-domain heavy chain antibody, can solve the problems of undiscovered patent publications, etc., and achieve high binding specificity and good application effect

Inactive Publication Date: 2021-10-01
TIANJIN UNIVERSITY OF SCIENCE AND TECHNOLOGY +1
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Through the search, no patent publications related to the patent application of the present invention have been found

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nanometer antibody aiming at green fluorescent protein (GFP) and application thereof
  • Nanometer antibody aiming at green fluorescent protein (GFP) and application thereof
  • Nanometer antibody aiming at green fluorescent protein (GFP) and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1: Construction of a Nanobody library for GFP:

[0044] (1) The concentration of GFP is 500 micrograms per milliliter, and 1 mg of GFP is mixed with Freund's adjuvant in equal volume for each immunization, and a Xinjiang Bactrian camel is immunized once a week, a total of 4 times, except for the first use Complete Freund's adjuvant, and Freund's incomplete adjuvant for the remaining several times, stimulate B cells to express antigen-specific nanobodies during the immunization process.

[0045] (2) After the 4 times of immunization, extract 100 ml of camel peripheral blood lymphocytes and extract total RNA, referring to the RNA extraction kit provided by QIAGEN.

[0046](3) According to the instructions of Super-Script III FIRST STRANDSUPERMIX kit, the extracted RNA was reverse-transcribed into cDNA and the VHH chain was amplified by nested PCR. The first round of PCR:

[0047] Upstream primer: GTCCTGGCTGCTCTTCTACAAGGC

[0048] Downstream primer: GGTACGTGCTGTT...

Embodiment 2

[0057] Embodiment 2: Nanobody screening process against GFP:

[0058] (1) Dissolve in 100mM pH 8.2NaHCO 3 200 micrograms of GFP in the medium were coupled to a microtiter plate, placed overnight at 4°C, and a negative control was set up at the same time.

[0059] (2) On the second day, 100 microliters of 0.1% casein were added to the two wells respectively, and blocked for 2 hours at room temperature.

[0060] (3) After 2 hours, add 100 μl phage (8*10 11 tfu immunized camel nanobody phage display gene library) and acted for 1 hour at room temperature.

[0061] (4) Wash 5 times with PBST (PBS containing 0.05% Tween 20) to wash away unbound phages.

[0062] (5) Use triethylamine (100mM) to dissociate the phage that specifically binds to GFP, and infect Escherichia coli TG1 that is in logarithmic growth, produce and purify the phage for the next round of screening, the same screening process Repeat for 3-4 rounds. In the process of continuous screening, positive clones will ...

Embodiment 3

[0063] Embodiment 3: use the enzyme-linked immunosorbent method (ELISA) of phage to screen specificity single positive clone:

[0064] (1) From the cell culture dish containing phage after the above 3-4 rounds of selection, pick 96 single colonies and inoculate them in TB medium containing 100 micrograms per milliliter of ampicillin (1 liter of TB medium contains 2.3 grams of phosphoric acid Potassium dihydrogen, 12.52 grams of dipotassium hydrogen phosphate, 12 grams of peptone, 24 grams of yeast extract, 4 milliliters of glycerol), after growing to the logarithmic phase, add IPTG with a final concentration of 1 millimolar, and cultivate overnight at 28 ° C.

[0065] (2) Obtain the crudely extracted antibody by infiltration method, transfer the antibody to an antigen-coated ELISA plate, and place it at room temperature for 1 hour.

[0066] (3) Unbound antibodies were washed away with PBST, a mouse anti-HAtag antibody (anti-mouse anti-HA antibody, purchased from Beijing Kangwe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nano antibody aiming at green fluorescent protein (GFP). The amino acid sequence of the nano antibody is SEQ ID NO. 1. The invention discloses a nano-antibody gene sequence and a host cell, the nano-antibody is a single-domain antibody heavy-chain antibody capable of being specifically bound with GFP, can also be efficiently expressed in escherichia coli, and can be applied to purification and detection of GFP and GFP fusion protein.

Description

technical field [0001] The invention belongs to the technical field of single-domain heavy chain antibody and genetic engineering antibody (also known as nanobody technology), in particular to a nanobody against green fluorescent protein (GFP) and its application. Background technique [0002] Green fluorescent protein was first discovered in jellyfish by Osamu Shimomura and others in 1962. The protein produced by its gene will emit green fluorescence when excited by light in the blue wavelength range. GFP is a segment consisting of 238 amino acid residues with a size of about 27KDa. Its function is to label tags and is widely used in the fields of immunological detection, cell imaging, affinity purification and protein engineering. [0003] At present, most of the monoclonal or polyclonal antibodies against GFP are used for detection on the market. The development and production process of this traditional monoclonal antibody is extremely cumbersome and complicated, and the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/18C12N15/13C12N15/70C12N1/21C07K1/22B01D15/38C12R1/19
CPCC07K16/18C12N15/70C07K1/22B01D15/3804C07K2317/569C07K2317/92C07K2317/22
Inventor董春明毛桂燕张瑞许丽君
OwnerTIANJIN UNIVERSITY OF SCIENCE AND TECHNOLOGY