Echinococcus granulosus recombinant protein and preparation method thereof

A technology of Echinococcus granulosus and recombinant protein, applied in the field of genetic engineering, can solve the problems of affecting protein conformation, inducing immune pathological effects, toxic and side effects, etc., achieving the effects of simple genetic manipulation, rapid cell reproduction and low culture cost

Pending Publication Date: 2021-12-21
WEST CHINA HOSPITAL SICHUAN UNIV
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the methanol inducer used in the secretory protein expression process of this application is harmful and has potential safety hazards in the large-scale production process; and the expression system of the host Pichia pastoris GS115 has errors or excessive sugar content in the expression product. Kylation modification not only affects the conformation of the protein, but also has the adverse effect of shielding the protective epitope, and may induce immunopathological effects or other toxic side effects, and increases the complexity of the purification process in large-scale production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Echinococcus granulosus recombinant protein and preparation method thereof
  • Echinococcus granulosus recombinant protein and preparation method thereof
  • Echinococcus granulosus recombinant protein and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1: Modification method of Echinococcus granulosus immunogenic protein EG95

[0042] On the basis of the amino acid sequence of the complete EG95 protein, the signal peptide sequence of 16 amino acids was removed from the N-terminal, and the transmembrane hydrophobic domain of 18 amino acids was truncated from the C-terminal, and the codon usage was used according to the prokaryotic expression system of E. coli Codon optimization was performed on the full-length gene of EG95 preferentially to improve protein expression and enhance its hydrophilicity. The modified EG95 protein is a recombinant protein of Echinococcus granulosus, named EG95s, and the nucleotide sequence (5'-3') of the gene encoding EG95s is as follows:

[0043] CAAGAATATAAAGGTATGGGTGTTGAAACCCGTACCACCGAAACACCGCTGCGTAAACATTTTAATCTGACACCGGTTGGTAGCCAGGGTATTCGTCTGAGCTGGGAAGTTCAGCATCTGAGCGATCTGAAAGGCACCGATATTAGCCTGAAAGCAGTTAATCCGAGCGATCCGCTGGTGTATAAACGTCAGACCGCAAAATTTAGTGATGGCCAGCTGACCATTGGTGAACTGAAACCGA...

Embodiment 2

[0047] Embodiment 2: the method for preparing EG95s recombinant protein

[0048] Step 1. Construct the modified EG95s gene sequence according to the method in Example 1.

[0049] Step 2, construction of recombinant expression plasmid pET28a-EG95s

[0050] ① The modified EG95s gene sequence was gene-synthesized, and after PCR amplification, it was connected to the pET-28a vector (TaKaRa, Japan) through BamHI and XhoI (TaKaRa, Japan) restriction sites to construct the pET28a-EG95s expression vector. During the above PCR amplification, the primer pairs used are:

[0051] Upstream primer: 5'-GGATCCCAAGAATATAAAGGTATGGGT-3' (SEQ ID NO: 3);

[0052] Downstream primer: 5'-CTCGAGTGCGCTACCGCT-3' (SEQ ID NO: 4).

[0053] ②Take Escherichia coli BL21(DE3) competent cells (Qingke Biotech, China) out of the -80°C refrigerator and place them on ice for 2 minutes. When the competent cells melt, add 2uL pET28a-EG95s expression vector and mix gently Ice-bathed for 30 minutes, then placed in ...

experiment example 1

[0061] Experimental example 1: SDS-PAGE analysis of EG95s recombinant protein

[0062] 1. Experimental method

[0063] (1) Expression of EG95s

[0064] Referring to the method in step 3 of Example 2, the recombinant expression strain EG95s-1 was inoculated into LB culture medium containing 20 μg / mL kana, and cultivated to the OD of the bacterial solution 600 At 6 o'clock, IPTG was added to a final concentration of 0.5 mM, and then placed on a shaker at 37° C. at 200 rpm to induce expression, and the bacterial liquid was collected every 1 h. Centrifuge the collected bacterial solution for 20 minutes under the condition of centrifugal force of 13000g, collect the precipitate and resuspend it with 20mM PBS, ultrasonically lyse it on ice (power 300w, work 5s, interval 5s, total time 20min), add 5x to 1 / 4 volume Protein loading buffer (NCM Biotech, China), boiled in a metal bath at 100°C for 10 minutes, centrifuged at 12,000 g for 5 minutes, and the whole bacteria, supernatant, a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
purityaaaaaaaaaa
Login to View More

Abstract

The invention discloses an echinococcus granulosus recombinant protein and a preparation method thereof, and belongs to the field of gene engineering. The amino acid sequence of the echinococcus granulosus recombinant protein is as shown in SEQ ID NO: 2, and the nucleotide sequence of the gene for coding the echinococcus granulosus recombinant protein is as shown in SEQ ID NO: 1. The echinococcus granulosus recombinant protein EG95s can be subjected to soluble expression in escherichia coli, does not change an antigenic determinant sequence of the EG95 protein, and has biological activity of an antigen / induction host protection function. The preparation method of the echinococcus granulosus recombinant protein is safe, efficient, economical, simple and convenient, the problem that a strong denaturing agent is used in the preparation process of the existing echinococcus granulosus recombinant protein is solved, the expression quantity of the obtained echinococcus granulosus recombinant protein accounts for 20% or above of the total protein of thalli, the purity is as high as 90%, and the yield of the echinococcus granulosus recombinant protein is high. The echinococcus granulosus recombinant protein has a wide application prospects in preparation of echinococcus granulosus vaccines.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a recombinant protein of Echinococcus granulosus and a preparation method thereof. Background technique [0002] Echinococcosis, also known as echinococcosis, is a zoonotic disease caused by the parasitism of the larvae of Echinococcus granulosus (Echinococcus) and Echinococcus multilocularis larvae (alveolar coccus) are caused by parasitic human and animal tissues and organs. Echinococcosis is distributed worldwide and is more common in countries and regions with developed animal husbandry. In China, it is mainly prevalent in western pastoral or semi-pastoral areas, seriously threatening the public health and the development of animal husbandry in China. [0003] At present, the treatment of echinococcosis is mainly based on surgery, supplemented by drug treatment, and the prevention is mainly based on health promotion. Due to the lack of early specific clinical ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/435C07K1/16C12N15/12C12N15/70C12N1/21A61K39/00A61P33/14C12R1/19
CPCC07K14/43554C12N15/70A61K39/0003A61P33/14C12N2800/22C12N2800/101
Inventor张艺琳刘杰刘开云
OwnerWEST CHINA HOSPITAL SICHUAN UNIV