Rubber tree erysiphaceae avirulence gene screening method, effect protein and application

A technology of rubber tree powdery mildew and non-toxic genes, which is applied in the field of microbial genetic engineering, can solve the problems of difficulty and limitation in the development of rubber tree disease-resistant varieties, and achieve stable expression, faster screening and identification, and high activity. Effect

Pending Publication Date: 2022-02-01
HAINAN UNIVERSITY
View PDF7 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the avirulent gene of powdery mildew of rubber tree has not been reported yet, because powdery mildew itself cannot be genetically manipulated or exogenously transformed, it is limited by technology, and a reliable genetic manipulation technology has not yet been established for powdery mildew, and The difficulty of genetic manipulation of Hevea brasiliensis greatly limits the development of rubber tree disease-resistant varieties. Therefore, finding a screening method for non-toxic genes of rubber powdery mildew is beneficial for the establishment of rubber powdery mildew prevention and control system and disease resistance. Breeding of varieties provides important technical support

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rubber tree erysiphaceae avirulence gene screening method, effect protein and application
  • Rubber tree erysiphaceae avirulence gene screening method, effect protein and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 - Construction of expression vector of rubber tree white powder effect protein

[0031] The present invention takes an example of the encoding gene of a potential effect protein SP04187. Poptrophy effect protein SP04187 encoding gene cDNA sequence clone to a PFL2 fungi expression vector containing T7 promoter and heteromycin G418 resistance gene, inserting the white powder effect protein coding gene before the 3 × HA tag, in a ceile After the constitutive promoter CGRP60 of anthrachene ribosomal protein, the expression vector of the rubber tree glutinum effect protein is obtained;

[0032] Wherein, CgRP60 promoter nucleotide sequence of the promoter is GATTCAGCGAGCGCAGTGCCCCCAAAGACTTGGAGAGACGCGAGCCTGGACGTCGGGCGAAATCGTGGGAGTCGCGGGCGAAAAAATCGCAAAAAATGAGGAGATGGTCGCGGAGGACACGCAACGGGCGCCTGGTGGTCGGGAGAGTCGAAAGTTGGGTTTCGGGGGAAACAAAAGGAAGTGGCGTTGGAGTTGGCAAGTTTATATCTGCTGGCCTGGGGGTGGGAATCAGTGGTACTTCCAGCACTGTGCCTCTGCCTTATTACCAGCCTGGACTTCCAGGCTTTCGGAAGAAGCAGTGGCTCCGGTTCCGGGAG...

Embodiment 2

[0038] Example 2 Expression conversion of recombinant plasmid containing rubber tree white powder effect protein gene

[0039] After the expression carrier of the rubber tree white powder effect protein gene is constructed by the method of the above Example 1, the recombinant plasmid containing the rubber-containing treated bacteria effector protein gene is converted to the rubber braderia by PEG-mediated protoplast transformation. Turn.

[0040] Its PEG-mediated protoplast transformation method, including the following steps:

[0041] A. Activated rubberite strain, at 28 ° C, 150 rpm oscillated culture for 12 hours, collected by mycelium, dissolved in 5 hours, obtain protoplasts, adjust the concentration to 1 × 10 6 / Ml;

[0042] B. Wash the original plastics with buffer, mix resolve per 100 μl of raw material suspension and 10 ng recombinant plasmid, incubate and transform 40% PEG4000 solution;

[0043] C. The transformed protoplast was screened on a PDA medium containing 200 μ...

Embodiment 3

[0044] Example 3 - Screening, culture and inoculation of anthrachene transformants

[0045] 1. The present invention is based on the measured effect protein design PCR primer, F primers: ggcctataccctcgagcgg; R primer: ttagatcatcggaattccg; and use of quantitative PCR detection of effect protein in the strain, using the formation of heteromycin G418 resistance screening anthraneous transformation At the same time, the expression effect of the white powder effect protein gene expression in the anthraneous transformant was determined by 3 × HA tag prior to detection, and the expression of anthranegic bacon transfection was highly expressed.

[0046] 2, the expression of anthraneous anthraneous transformation is inoculated into potato sucrose liquid medium, in 28 ° C, 120 rpm shaker potato sucrose liquid medium for 24 hours, collecting spores, culturing it The bacterial block is inoculated to the exile rubber blade, and the rubber tree leaves were placed in moisturizing petri dishes fo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a rubber tree erysiphaceae avirulence gene screening method, effect protein and application. The screening method comprises the following steps: (1) selecting a coding gene A of potential effect protein from rubber tree erysiphaceae genes; (2) constructing a rubber tree erysiphaceae effect protein expression vector, and expressing and transforming a potential effect protein gene A of erysiphaceae in colletotrichum gloeosporioides to obtain a colletotrichum transformant; and (3) culturing the colletotrichum transformant with high expression degree of the effect protein, inoculating the colletotrichum transformant to an in-vitro rubber leaf, determining the pathogenic ability of the colletotrichum transformant, and if the pathogenicity of the colletotrichum gloeosporioides transformant is reduced compared with that of wild colletotrichum gloeosporioides, indicating that the effect protein coding gene A is an avirulence gene. According to the screening method disclosed by the invention, the erysiphaceae avirulence gene can be directly screened through pathogenicity of protein gene transformants with different effects, so that the avirulence gene of the erysiphaceae of the rubber tree can be more quickly screened and identified, and prevention and control of rubber erysiphaceae and breeding of disease-resistant varieties can be enhanced.

Description

Technical field [0001] The present invention relates to the technical field of microbial gene, and Background technique [0002] Polyfung fungi is a pathogenic fungi of plant white powder disease, which can cause serious production losses on important food crops and custries. Rubber tree white powder is a common leaf disease in rubber trees, rubber tree white powder infected important economic crops, Brazilian rubber trees, affecting the growth of rubber trees, causing natural rubber production significantly decline. At present, the research on the genetic diversity of rubber trees is still less. [0003] Non-toxic genes are generally encoded as proteins that have triggered plants resistant reactions in pathogen. In the wheat white powder, white powder has been identified as a special living body parasitic, and a non-toxic gene of a variety of wheat white powder is discovered, which has great significance for the breeding of crops. However, the non-toxic gene of rubber tree white...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/31C12N15/80C12N1/15C12Q1/6895C12R1/645
CPCC07K14/37C12N15/80C12Q1/6895C12Q2600/158
Inventor李潇刘梦瑶殷金瑶刘玉涵林春花缪卫国
OwnerHAINAN UNIVERSITY