Rubber tree erysiphaceae avirulence gene screening method, effect protein and application
A technology of rubber tree powdery mildew and non-toxic genes, which is applied in the field of microbial genetic engineering, can solve the problems of difficulty and limitation in the development of rubber tree disease-resistant varieties, and achieve stable expression, faster screening and identification, and high activity. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1 - Construction of expression vector of rubber tree white powder effect protein
[0031] The present invention takes an example of the encoding gene of a potential effect protein SP04187. Poptrophy effect protein SP04187 encoding gene cDNA sequence clone to a PFL2 fungi expression vector containing T7 promoter and heteromycin G418 resistance gene, inserting the white powder effect protein coding gene before the 3 × HA tag, in a ceile After the constitutive promoter CGRP60 of anthrachene ribosomal protein, the expression vector of the rubber tree glutinum effect protein is obtained;
[0032] Wherein, CgRP60 promoter nucleotide sequence of the promoter is GATTCAGCGAGCGCAGTGCCCCCAAAGACTTGGAGAGACGCGAGCCTGGACGTCGGGCGAAATCGTGGGAGTCGCGGGCGAAAAAATCGCAAAAAATGAGGAGATGGTCGCGGAGGACACGCAACGGGCGCCTGGTGGTCGGGAGAGTCGAAAGTTGGGTTTCGGGGGAAACAAAAGGAAGTGGCGTTGGAGTTGGCAAGTTTATATCTGCTGGCCTGGGGGTGGGAATCAGTGGTACTTCCAGCACTGTGCCTCTGCCTTATTACCAGCCTGGACTTCCAGGCTTTCGGAAGAAGCAGTGGCTCCGGTTCCGGGAG...
Embodiment 2
[0038] Example 2 Expression conversion of recombinant plasmid containing rubber tree white powder effect protein gene
[0039] After the expression carrier of the rubber tree white powder effect protein gene is constructed by the method of the above Example 1, the recombinant plasmid containing the rubber-containing treated bacteria effector protein gene is converted to the rubber braderia by PEG-mediated protoplast transformation. Turn.
[0040] Its PEG-mediated protoplast transformation method, including the following steps:
[0041] A. Activated rubberite strain, at 28 ° C, 150 rpm oscillated culture for 12 hours, collected by mycelium, dissolved in 5 hours, obtain protoplasts, adjust the concentration to 1 × 10 6 / Ml;
[0042] B. Wash the original plastics with buffer, mix resolve per 100 μl of raw material suspension and 10 ng recombinant plasmid, incubate and transform 40% PEG4000 solution;
[0043] C. The transformed protoplast was screened on a PDA medium containing 200 μ...
Embodiment 3
[0044] Example 3 - Screening, culture and inoculation of anthrachene transformants
[0045] 1. The present invention is based on the measured effect protein design PCR primer, F primers: ggcctataccctcgagcgg; R primer: ttagatcatcggaattccg; and use of quantitative PCR detection of effect protein in the strain, using the formation of heteromycin G418 resistance screening anthraneous transformation At the same time, the expression effect of the white powder effect protein gene expression in the anthraneous transformant was determined by 3 × HA tag prior to detection, and the expression of anthranegic bacon transfection was highly expressed.
[0046] 2, the expression of anthraneous anthraneous transformation is inoculated into potato sucrose liquid medium, in 28 ° C, 120 rpm shaker potato sucrose liquid medium for 24 hours, collecting spores, culturing it The bacterial block is inoculated to the exile rubber blade, and the rubber tree leaves were placed in moisturizing petri dishes fo...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com


