Thermostable lactase preparation method

A lactase, high temperature-resistant technology, applied in the biological field, can solve the problems of low expression and insufficient large-scale production, and achieve the effects of simple steps, low cost, and improved nutritional value

Inactive Publication Date: 2006-07-26
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI +1
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The CelB gene cloned from the high-temperature-resistant archaea was once expressed in the Escherichia coli expression system (VoorhorstW., et al, J.Bacteriol., 177, 7105-7111, 1995; Lebbink J., et al, Methods Enzymol, 330, 364- 379, 2001) and Pichia pastoris system (Smith J., et al., Biotechnol. Bioeng., 79(7): 713-723, 2002), but the expression levels are very low, not enough for large-scale Production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Thermostable lactase preparation method
  • Thermostable lactase preparation method
  • Thermostable lactase preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1, cloning and sequence analysis of CelB gene

[0035] 1. Preparation of genomic DNA of Pyrococcus furiosus containing CelB gene

[0036] (1) Pick a single colony and culture overnight.

[0037] (2) Centrifuge at 12,000 rpm for 2 minutes, and remove the supernatant.

[0038] (3) Add 500 μl of 0.05M Tris-Cl (pH 8.0) buffer containing 25% sucrose to the precipitation, mix and resuspend, add 100 μl of 5 mg / ml lysozyme, mix well, and incubate at 20°C for 1 hr.

[0039] (4) Add SET solution (150 mM NaCl, 1 Mm EDTA, 20 mM Tris-Cl pH 8.0), 500 μl 5% SDS and 100 μl 20 mg / ml proteinase K, mix well, and incubate at 37° C. for 1 hr.

[0040] (5) Add an equal volume of chloroform / isoamyl alcohol (24:1), mix well, centrifuge at 11,000 g for 5 min, and transfer the supernatant to a new tube.

[0041] (6) Add an equal volume of phenol / chloroform / isoamyl alcohol (25:24:1), mix well, centrifuge at 11,000 g for 5 min, and transfer the supernatant to a new tube.

[0042] (7...

Embodiment 2

[0073] Embodiment two, the construction of recombinant transfer vector pVL94 (CelB)

[0074] Firstly, a pair of mutant primers were designed, the primer sequences are as follows:

[0075] Primer1: 5'gggatcccgatggtgggggtgtatgaataattcggaatattt

[0076] Primer2: 5'aaagcttaactttatcc aataatatat tatgtata

[0077] Primer1 mutates the start codon ATG of the polyhedron to ATT, and at the same time introduces a BamH I site at the 5' end, retaining the 35bp polyhedron gene sequence to stabilize the transcription product of the foreign gene and improve translation efficiency; in the reverse direction The HindIII site was introduced into Primer2 to facilitate gene cloning.

[0078] The DNA of the wild BmNPV was used as a template for PCR amplification, and the amplified fragment was double digested with BamH I and HindIII, and then cloned into the HindIII and BamH I sites of pUC18 (purchased from Gibco Company) to obtain the vector pUC-BH. The pVL1393 vector (purchased from Clontech) was ...

Embodiment 3

[0080] Embodiment three, the reproduction of Bombyx mori nuclear polyhedrosis virus parent strain BmNPV and the preparation of virus DNA

[0081] Prepare 1 × TC-100 medium according to the product instructions of GIBCO Company, adjust the pH to 6.22 with 2N NaOH, add 10% fetal bovine serum to the filter-sterilized medium, and cultivate silkworm cell Bm-5 at 27°C. Infect about 50ml of cells in the logarithmic growth phase with the parental strain of Bombyx mori nuclear polyhedrosis virus BmNPV, and the multiplicity of infection is 1. After 3 to 4 days, collect the virus infection solution, centrifuge (5,000rpm×10min), remove the precipitate, and centrifuge the supernatant at 25,000rpm 1 hour, remove the supernatant, suspend the virus particle pellet with 1ml virus DNA extraction solution (1,000ml containing 12.1g Tris, 33.6g EDTA, 14.1g KCl, pH7.5), transfer to a 1.5ml centrifuge tube, add protease K to a final concentration of 50 μg / ml, incubated at 50°C for 2 hours, then adde...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention discloses a new preparation for the heatproof lactobionic enzyme, which belongs to the biology technique filed. This invention includes the following steps: constructing the heatproof lactobionic enzyme gene onto the baculoviral vector to obtain the recombining baculoviral vector; through internal or external combining, conforming the heatproof lactobionic enzyme gene on the baculoviral gene group to obtain the recombining baculoviral; using the obtained recombining baculoviral to infect the insect host; culturing the infected insect hose to do the heatproof lactobionic enzyme expression; collecting and purifying the expression product. This invention can produce cheap heatproof l lactobionic enzyme with high efficient and large scale, and the product can be used in foodstuff and feedstuff production field extensively.

Description

technical field [0001] The invention relates to an enzyme production method, in particular to a method for producing high-temperature-resistant lactase by using a baculovirus expression system, and belongs to the field of biotechnology. Background technique [0002] The bioreactor of the baculovirus expression system was established in the 1980s. Since the first high-efficiency expression of human alpha-interferon using the baculovirus expression system in 1983 (Smith, Mol. Cell Biol., 3: 2156-2165, 1983), dozens of foreign genes have been highly expressed, In my country alone there are α-interferon (Yang Guanzhen et al., Acta Biochemistry and Biophysics, 22:355-361, 1990), arrowhead protease inhibitors (Ji Ping, Sericulture Science, 21:223-227, 1995), Marek's virus glycoprotein B (Xiao Qingli et al., Sericulture Science, 23:104-108, 1997) and many others. The advantages of using this system to produce high-temperature-resistant lactase are: 1. The expression efficiency of t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/38C12N15/866C12N15/85C12N7/01C12N15/56
Inventor张志芳林旭瑷姚斌陈寅张伟范云六沈桂芳
OwnerTHE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI