44 results about "Pre eclampsie" patented technology

The invention discloses a pre-eclampsia prediction method and system based on machine learning and early pregnancy indexes. The pre-eclampsia prediction method comprises the following steps: acquiring early pregnancy laboratory index data and FMF model evaluation parameters of a to-be-predicted pregnant woman; based on a preset preeclampsia type, performing feature screening on the early pregnancy laboratory index data by using a Boruta algorithm to construct corresponding original features; inputting the original features into a trained first-level machine learning prediction model corresponding to the pre-eclampsia type to obtain a risk score; according to the risk score and an FMF model evaluation parameter, obtaining a joint feature; and inputting the joint features into a trained second-stage machine learning prediction model corresponding to the pre-eclampsia type to obtain a corresponding pre-eclampsia risk prediction result. According to the method, information of different sources and different physiological dimensions is deeply fused, analyzed and judged, and high-precision and low-cost early prediction of different pre-eclampsia types is realized.

The disclosure describes changes in cfRNA gene expression that are associated with risk for preeclampsia. Accordingly, the disclosure provides methods and kits for preeclampsia risk assessment.

Provided are diagnostic and / or screening tests, assays and devices for preeclampsia (PE). The diagnostic and / or screening tests, assays and devices include test antibodies for activin A and / or inhibin A. The PE diagnostic and / or screening tests, assays and devices are capable of detecting activin A and / or inhibin A in a sample at a concentration of less than about 60 pg / mL. Corresponding methods of diagnosing and / or screening for PE are provided.

The invention discloses a preeclampsia biomarker and an application of the preeclampsia biomarker. The preeclampsia biomarker comprises at least one of a fusion gene PSPC1-MRPS31P2 and a fusion gene LINC00630-AL035494. The preeclampsia biomarker can be used for detecting preeclampsia. The preeclampsia biomarker provided by the invention can provide a non-invasive diagnosis scheme for clinical prenatal preeclampsia, and preeclampsia specific high-expression fusion genes (PSPC1-MRPS31P2 and LINC00630-AL035494) in peripheral blood of a pregnant woman are detected through real-time quantitative PCR (Polymerase Chain Reaction), so that preeclampsia early prediction, disease diagnosis and monitoring of the state of a patient in the illness period are realized; and in combination with the existing clinical diagnosis scheme, the accuracy of pre-eclampsia diagnosis is improved.

The application provides use of zanamivir in preparation of a medicine for treating or preventing preeclampsia, and a corresponding medicine and treatment method; zanamivir can effectively improve high blood pressure, proteinuria, creatinine, neuraminidase and sialic acid elevation symptoms of preeclampsia, increase NO level, and improve pregnancy outcome. Zanamivir and hydroxyprogesterone caproate in combination show better effects.

The present invention relates to a disease-specific biomarker for early prediction and diagnosis of preeclampsia, and use thereof. A composition for predicting or diagnosing preeclampsia or a method for providing information for prediction or diagnosis of preeclampsia, according to one aspect, can simply and effectively predict or diagnose a disease by measuring and comparing the level of mRNA of a disease-specific protein that changes in a patient, or an mRNA of a gene encoding same.

The present disclosure relates to a method and device for predicting the risk of preeclampsia by utilizing an artificial intelligence model. One embodiment of the present disclosure may provide a method for predicting the risk of preeclampsia by utilizing an artificial intelligence model, the method comprising the steps of: inputting data about an expectant mother to a preeclampsia prediction model generated on the basis of a training data set; and acquiring an incidence rate of the preeclampsia from the preeclampsia prediction model, wherein the data about the expectant mother includes final variables determined from a plurality of initial variables of the training data set.

Provided herein are methods for diagnosing pre-eclampsia, methods for determining the risk of a subject developing pre-eclampsia, as well as methods for preventing and treating pre-eclampsia should the subject be found to have, or be at risk of developing, pre-eclampsia. The methods involve determining a level of at least three transposable element subfamilies in a sample, wherein differential expression of the transposable element subfamilies relative to reference values indicates that the subject is at risk of developing, or has, pre-eclampsia.

A system (100) for preparing and evaluating rapidly dissolving hydralazine hydrochloride buccal films for the treatment of preeclampsia and eclampsia, comprising: a) a polymer preparation unit (102) configured to prepare polymer solutions using polymers selected from the group consisting of hydroxypropyl methylcellulose, sodium alginate, and pectin; b) a drug incorporation unit (104) configured to incorporate hydralazine hydrochloride into the polymer solutions; c) a plasticizer and enhancer addition unit (106) configured to add and homogeneously mix glycerin and permeation enhancers to the drug-polymer mixture; d) a film casting unit (108) configured to cast the resulting homogeneous mixture onto a surface suitable for film formation; and e) a film drying unit (110) configured to dry the cast films at room temperature.

The invention belongs to the technical field of biological medicines, and particularly relates to application of lactobacillus jensenii-sourced nano-vesicles in preparation of a medicine for preventing and / or treating preeclampsia. The lactobacillus jensenii-sourced nano-vesicles are obtained by separating culture supernate of strains, the components are natural, toxic and side effects are avoided, good biocompatibility and safety are achieved, in-vivo and in-vitro experiments prove that the lactobacillus jensenii-sourced nano-vesicles can effectively promote proliferation, clone formation and migration of HTR-8 / SVneo cells, and the application of the lactobacillus jensenii-sourced nano-vesicles to preparation of the nano-vesicles is promoted. The negative effects of proliferation inhibition, clone formation reduction, migration weakening, cell cycle arrest, scratch self-healing ability reduction and the like of HTR-8 / SVneo cells caused by LPS stimulation can be reversed, and the placenta injury caused by a PE animal model formed by LPS modeling can be protected, so that the application can be used for preventing and / or treating preeclampsia; a new theoretical basis is provided for application and prevention and treatment of preeclampsia of the probiotics, so that the bacillus subtilis has a wide application prospect.

Provided are a pre-eclampsia biomarker and the use thereof. The pre-eclampsia biomarker comprises at least one of the fusion gene PSPC1-MRPS31P2 and the fusion gene LINC00630-AL035494. The pre-eclampsia biomarker provided can provide a non-invasive diagnostic scheme for clinical pre-eclampsia. By detecting the highly expressed pre-eclampsia-specific fusion genes (PSPC1-MRPS31P2 and LINC00630-AL035494) in the peripheral blood of pregnant women via real-time quantitative PCR, early prediction of pre-eclampsia, disease diagnosis, and monitoring of the status of patients during the illness can be realized. The marker can be combined with existing clinical diagnostic schemes to improve the accuracy of pre-eclampsia diagnosis.

A computer implemented method of early prediction of risk of pre-eclampsia in a pregnant obese woman is described. The method comprises the steps of inputting abundance values for a panel of obese pregnancy specific metabolite biomarkers obtained from an assayed biological sample into a computational model, in which the biological sample is obtained from an obese pregnant woman at 8 to 24 weeks of pregnancy, and inputting a patient parameter for the pregnant obese woman into the computational model selected from at least one of ethnicity, risk of gestational diabetes, fetal sex, number of pregnancies and level of obesity. The computational model is configured to select a subset comprising at least two of the obese pregnancy specific metabolite biomarkers based on the patient parameter input, correlate abundance values for the subset of obese pregnancy specific metabolite biomarkers with risk of pre-eclampsia, and output a predicted risk of pre-eclampsia for the pregnant obese woman.

This disclosure relates to improved detection of predictors of preeclampsia.

The present invention includes methods and materials for use in the detection preeclampsia and / or determining an increased risk for preeclampsia in a pregnant female, the method including identifying in a biosample obtained from the pregnant women a plurality of circulating RNA (C-RNA) molecules.

The present invention relates to the use of 6-gingerol in the preparation of a medicament for treating preeclampsia, belonging to the technical field of medicine. The present invention provides the use of 6-gingerol in the preparation of a medicament, health food or special medical food for treating preeclampsia. 6-Gingerol blocks the initiation of mitophagy by reducing the expression of BNIP3 and LC3, or regulates H / R-induced mitophagy by inhibiting the production of mitochondrial ROS, thereby playing a role in treating or preventing preeclampsia medicaments. The present invention discovers for the first time that 6-gingerol can block the initiation of mitophagy by reducing the expression of BNIP3 and LC3 or regulate H / R-induced mitophagy by inhibiting the production of mitochondrial ROS, so as to achieve the purpose of treating or preventing preeclampsia.

The present invention includes a method and computer program for detecting preeclampsia and / or determining an elevated risk of preeclampsia in a pregnant woman, the method comprising identifying cell free DNA signals, including concentration, fetal fraction and fragment size distribution, in a biological sample obtained from a pregnant woman. These methods provide for identifying patients at risk of preeclampsia three months before pregnancy.

The present disclosure relates to a disease-specific lipidome for the diagnosis and severity determination of pre-eclampsia. A composition for diagnosing pre-eclampsia and a composition for determining the severity of pre-eclampsia, according to an aspect, can diagnose pre-eclampsia and significantly determine the severity of the disease, by measuring and comparing the level of a lipidome that changes in patients.

The present invention concerns the field of diagnostic assays for prenatal diagnosis of preeclampsia. In particular, it relates to a method for diagnosing whether a pregnant subject is not at risk for preeclampsia within a short window of time comprising a) determining the amount of at least one angiogenesis biomarker selected from the group consisting of sFlt-1, Endoglin and PlGF in a sample of said subject, and b) comparing the amount with a reference, whereby a subject being not at risk for developing preeclampsia within a short period of time is diagnosed if the amount is identical or decreased compared to the reference in the cases of sFlt-1 and Endoglin and identical or increased in the case of PlGF, wherein said reference allows for making the diagnosis with a negative predictive value of at least about 98%. Further contemplates are devices and kits for carrying out said method.

Described herein are methods, compositions, kits, and systems for detecting free and bound PlGF, and using detection of such species to distinguish between pregnant women with or without preeclampsia or related conditions.

The present invention includes methods and materials for use in the detection preeclampsia and / or determining an increased risk for preeclampsia in a pregnant female, the method including identifying in a biosample obtained from the pregnant women a plurality of circulating RNA (C-RNA) molecules.

Provided herein compositions and methods for the treatment and prevention of preeclampsia or hypertensive disorders of pregnancy. In particular, provided herein are regulators of the Hippo pathway (e.g., TEAD inhibitors; VGLL2 regulators; verteporfin) that find use in the treatment and prevention of preeclampsia or hypertensive disorder of pregnancy.

A method for assessing the risk of preeclampsia in a pregnant subject is provided. The method can comprise: obtaining at least one blood pressure pulse waveform from at least one arterial site of the subject; determining a risk of preeclampsia in the subject, based at least in part on the at least one blood pressure pulse waveform; and generating an output indicative of the determined risk.

The present invention relates to a disease-specific biomarker for early prediction and diagnosis of pre-eclampsia and a use thereof. A composition for predicting or diagnosing pre-eclampsia or a method for providing information for such prediction or diagnosis according to an aspect can simply and effectively predict or diagnose a disease by measuring and comparing the level of a disease-specific protein that changes in patients or the mRNA level of a gene encoding the protein.

A method of treating or preventing eclampsia, pre-eclampsia, hypertensive disorder of pregnancy, or HELLP syndrome in a patient including contacting blood from the patient that contains circulatory soluble fms-like tyrosine-kinase-1 (sFLT-1) with an ex vivo filter, said filter having immobilizcd-hcparin or -heparin fragment, the immobil ized-heparin or -heparin fragment capable of binding the sFLT-1 under the contact conditions in the filter. Next, allowing sufficient time for the binding the sFLT-1 to yield depleted blood with less of the sFLT-1 and then returning the depleted blood to the patient to treat or prevent the eclampsia, pre-eclampsia, hypertensive disorder of pregnancy in the patient. Additionally, a system for performing the method of treating or preventing eclampsia, pre-eclampsia, hypertensive disorder of pregnancy, or HELLP syndrome in a patient.

A three-component composition for use in the treatment of preeclampsia and related disorders wherein a first component comprises a bimodal synthetic carbon particle mixture; a second component comprises a resin bead with at least one affinity ligand directed toward syncytiotrophoblast-derived factor sEndoglin and a third component comprises a resin bead with at least one affinity ligand directed toward syncytiotrophoblast-derived factor soluble Fms-like tyrosine kinase-1.

The invention provides a pharmaceutical composition. The pharmaceutical composition is prepared from an anti-platelet medicine, folic acid, 5-methyltetrahydrofolic acid and acceptable auxiliary materials. The composition has the advantages that the composition can be used for preventing and treating preeclampsia, and is particularly suitable for primary lying-in women, hypertension pregnant women and diabetes pregnant women. The composition provided by the invention aims at specific pregnant women, realizes precise medical treatment, improves the curative effect, reduces the side effect and increases the medication compliance.

The present disclosure provides biomarker panels, methods and kits for determining the probability for preeclampsia in a pregnant female, including preterm preeclampsia or preeclampsia at any gestational age. The disclosure is based, in part, on the discovery that certain proteins and peptides in biological samples obtained from a pregnant female are differentially expressed in pregnant females that have an increased risk of developing, in the future, or presently suffering from, preeclampsia relative to matched controls. The disclosure is also partially based on the unexepected discovery that panels combining one or more of these proteins / peptides can be utilized in methods of determining the probability for preeclampsia in a pregnant female with relatively high sensitivity and specificity. These proteins and peptides dislosed herein serve as biomarkers for classifying test samples, predicting a probability of preeclampsia, monitoring of progress of preeclampsia, either individually or in a panel of biomarkers.

Disclosed are methods and apparatuses for treating a pregnancy related hypertensive disorder, such as pre-eclampsia and eclampsia, using ex vivo treatment with an anti-sEng antibody bound to a solid support in order to reduce blood levels of sEng. The present invention provides a method of treating or preventing a disorder associated with soluble Endoglin (sEng), such as a pregnancy-related hypertensive disorder, in a subject in need thereof comprising providing ex vivo to the subject anti-sEng antibodies or sEng-binding fragments thereof in an amount sufficient and for a time sufficient to decrease the subject's blood levels of sEng to treat or prevent the disorder associated with sEng in the subject.

Biomarkers tests which can be used to predict a positive or negative risk of preeclampsia are described. More specifically, a panel of biomarkers including MMP-7 and gpIIbIIIa, described. The test is useful to predict preeclampsia when a biological sample is obtained between the 16th and 22nd week of pregnancy. Prediction later in pregnancy can be achieved by a combination of Siglec-6, Activin A, ALCAM, and / or FCN2.

To provide a therapeutic pharmaceutical composition in the treatment or management of a disease or disorder in a subject.SOLUTION: A double-stranded RNA (dsRNA) comprising an antisense strand and a sense strand, wherein each strand has a 5' end and a 3' end; (1) the antisense strand comprises a sequence that is substantially complementary to the nucleic acid sequence of 5' CTCTCGGAATTCTCCATAACAAATATTT3 ' (SEQ ID NO: 1); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 50% 2'-O-methyl modification; (4) the nucleotides at any one or more of positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 20 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; And the like. Therapeutic pharmaceutical compositions are provided.SELECTED DRAWING: None