23 results about "Pre eclampsie" patented technology

The invention discloses a pre-eclampsia prediction method and system based on machine learning and early pregnancy indexes. The pre-eclampsia prediction method comprises the following steps: acquiring early pregnancy laboratory index data and FMF model evaluation parameters of a to-be-predicted pregnant woman; based on a preset preeclampsia type, performing feature screening on the early pregnancy laboratory index data by using a Boruta algorithm to construct corresponding original features; inputting the original features into a trained first-level machine learning prediction model corresponding to the pre-eclampsia type to obtain a risk score; according to the risk score and an FMF model evaluation parameter, obtaining a joint feature; and inputting the joint features into a trained second-stage machine learning prediction model corresponding to the pre-eclampsia type to obtain a corresponding pre-eclampsia risk prediction result. According to the method, information of different sources and different physiological dimensions is deeply fused, analyzed and judged, and high-precision and low-cost early prediction of different pre-eclampsia types is realized.

The disclosure describes changes in cfRNA gene expression that are associated with risk for preeclampsia. Accordingly, the disclosure provides methods and kits for preeclampsia risk assessment.

The invention discloses a preeclampsia biomarker and an application of the preeclampsia biomarker. The preeclampsia biomarker comprises at least one of a fusion gene PSPC1-MRPS31P2 and a fusion gene LINC00630-AL035494. The preeclampsia biomarker can be used for detecting preeclampsia. The preeclampsia biomarker provided by the invention can provide a non-invasive diagnosis scheme for clinical prenatal preeclampsia, and preeclampsia specific high-expression fusion genes (PSPC1-MRPS31P2 and LINC00630-AL035494) in peripheral blood of a pregnant woman are detected through real-time quantitative PCR (Polymerase Chain Reaction), so that preeclampsia early prediction, disease diagnosis and monitoring of the state of a patient in the illness period are realized; and in combination with the existing clinical diagnosis scheme, the accuracy of pre-eclampsia diagnosis is improved.

The application provides use of zanamivir in preparation of a medicine for treating or preventing preeclampsia, and a corresponding medicine and treatment method; zanamivir can effectively improve high blood pressure, proteinuria, creatinine, neuraminidase and sialic acid elevation symptoms of preeclampsia, increase NO level, and improve pregnancy outcome. Zanamivir and hydroxyprogesterone caproate in combination show better effects.

Provided herein are methods for diagnosing pre-eclampsia, methods for determining the risk of a subject developing pre-eclampsia, as well as methods for preventing and treating pre-eclampsia should the subject be found to have, or be at risk of developing, pre-eclampsia. The methods involve determining a level of at least three transposable element subfamilies in a sample, wherein differential expression of the transposable element subfamilies relative to reference values indicates that the subject is at risk of developing, or has, pre-eclampsia.

Provided are a pre-eclampsia biomarker and the use thereof. The pre-eclampsia biomarker comprises at least one of the fusion gene PSPC1-MRPS31P2 and the fusion gene LINC00630-AL035494. The pre-eclampsia biomarker provided can provide a non-invasive diagnostic scheme for clinical pre-eclampsia. By detecting the highly expressed pre-eclampsia-specific fusion genes (PSPC1-MRPS31P2 and LINC00630-AL035494) in the peripheral blood of pregnant women via real-time quantitative PCR, early prediction of pre-eclampsia, disease diagnosis, and monitoring of the status of patients during the illness can be realized. The marker can be combined with existing clinical diagnostic schemes to improve the accuracy of pre-eclampsia diagnosis.

A computer implemented method of early prediction of risk of pre-eclampsia in a pregnant obese woman is described. The method comprises the steps of inputting abundance values for a panel of obese pregnancy specific metabolite biomarkers obtained from an assayed biological sample into a computational model, in which the biological sample is obtained from an obese pregnant woman at 8 to 24 weeks of pregnancy, and inputting a patient parameter for the pregnant obese woman into the computational model selected from at least one of ethnicity, risk of gestational diabetes, fetal sex, number of pregnancies and level of obesity. The computational model is configured to select a subset comprising at least two of the obese pregnancy specific metabolite biomarkers based on the patient parameter input, correlate abundance values for the subset of obese pregnancy specific metabolite biomarkers with risk of pre-eclampsia, and output a predicted risk of pre-eclampsia for the pregnant obese woman.

The present disclosure relates to a disease-specific lipidome for the diagnosis and severity determination of pre-eclampsia. A composition for diagnosing pre-eclampsia and a composition for determining the severity of pre-eclampsia, according to an aspect, can diagnose pre-eclampsia and significantly determine the severity of the disease, by measuring and comparing the level of a lipidome that changes in patients.

Provided herein compositions and methods for the treatment and prevention of preeclampsia or hypertensive disorders of pregnancy. In particular, provided herein are regulators of the Hippo pathway (e.g., TEAD inhibitors; VGLL2 regulators; verteporfin) that find use in the treatment and prevention of preeclampsia or hypertensive disorder of pregnancy.

A method for assessing the risk of preeclampsia in a pregnant subject is provided. The method can comprise: obtaining at least one blood pressure pulse waveform from at least one arterial site of the subject; determining a risk of preeclampsia in the subject, based at least in part on the at least one blood pressure pulse waveform; and generating an output indicative of the determined risk.

A method of treating or preventing eclampsia, pre-eclampsia, hypertensive disorder of pregnancy, or HELLP syndrome in a patient including contacting blood from the patient that contains circulatory soluble fms-like tyrosine-kinase-1 (sFLT-1) with an ex vivo filter, said filter having immobilizcd-hcparin or -heparin fragment, the immobil ized-heparin or -heparin fragment capable of binding the sFLT-1 under the contact conditions in the filter. Next, allowing sufficient time for the binding the sFLT-1 to yield depleted blood with less of the sFLT-1 and then returning the depleted blood to the patient to treat or prevent the eclampsia, pre-eclampsia, hypertensive disorder of pregnancy in the patient. Additionally, a system for performing the method of treating or preventing eclampsia, pre-eclampsia, hypertensive disorder of pregnancy, or HELLP syndrome in a patient.

The invention provides a pharmaceutical composition. The pharmaceutical composition is prepared from an anti-platelet medicine, folic acid, 5-methyltetrahydrofolic acid and acceptable auxiliary materials. The composition has the advantages that the composition can be used for preventing and treating preeclampsia, and is particularly suitable for primary lying-in women, hypertension pregnant women and diabetes pregnant women. The composition provided by the invention aims at specific pregnant women, realizes precise medical treatment, improves the curative effect, reduces the side effect and increases the medication compliance.

The present disclosure provides biomarker panels, methods and kits for determining the probability for preeclampsia in a pregnant female, including preterm preeclampsia or preeclampsia at any gestational age. The disclosure is based, in part, on the discovery that certain proteins and peptides in biological samples obtained from a pregnant female are differentially expressed in pregnant females that have an increased risk of developing, in the future, or presently suffering from, preeclampsia relative to matched controls. The disclosure is also partially based on the unexepected discovery that panels combining one or more of these proteins / peptides can be utilized in methods of determining the probability for preeclampsia in a pregnant female with relatively high sensitivity and specificity. These proteins and peptides dislosed herein serve as biomarkers for classifying test samples, predicting a probability of preeclampsia, monitoring of progress of preeclampsia, either individually or in a panel of biomarkers.

Disclosed are methods and apparatuses for treating a pregnancy related hypertensive disorder, such as pre-eclampsia and eclampsia, using ex vivo treatment with an anti-sEng antibody bound to a solid support in order to reduce blood levels of sEng. The present invention provides a method of treating or preventing a disorder associated with soluble Endoglin (sEng), such as a pregnancy-related hypertensive disorder, in a subject in need thereof comprising providing ex vivo to the subject anti-sEng antibodies or sEng-binding fragments thereof in an amount sufficient and for a time sufficient to decrease the subject's blood levels of sEng to treat or prevent the disorder associated with sEng in the subject.

To provide a therapeutic pharmaceutical composition in the treatment or management of a disease or disorder in a subject.SOLUTION: A double-stranded RNA (dsRNA) comprising an antisense strand and a sense strand, wherein each strand has a 5' end and a 3' end; (1) the antisense strand comprises a sequence that is substantially complementary to the nucleic acid sequence of 5' CTCTCGGAATTCTCCATAACAAATATTT3 ' (SEQ ID NO: 1); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 50% 2'-O-methyl modification; (4) the nucleotides at any one or more of positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 20 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; And the like. Therapeutic pharmaceutical compositions are provided.SELECTED DRAWING: None

The present invention refers to an in vitro method for the determination of the risk of a subject suffering of preeclampsia as well as computer implemented methods thereof.

Provided are methods of evaluating risk for, diagnosing, and / or treating preeclampsia in a subject based on levels of transthyretin fibrils, oligomers or aggregates that can be detected using structure-specific polypeptide probes selective for aggregated transthyretin. Also provided are methods of monitoring the efficacy of a therapeutic administered to treat preeclampsia using these polypeptide probes.

The present invention provides a pharmaceutical composition for treating or preventing preeclampsia, the pharmaceutical composition containing a VEGFR-2-specific ligand that activates VEGFR-2 without activating VEGFR-1.

A system comprises a first sensor for generating a swelling signal based on the user pressing on the first sensor with a body part, a second sensor for generating a blood signal which is indicative of the volume of blood in the body part when the user presses on the first sensor and a force sensor for measuring the force applied by the body part to the first sensor when the user presses on the first sensor. The system also comprises a processor configured to determine an indication of swelling for the body part based on the swelling signal when the force sensor measures a first pre-determined value, determine an indication of blood pressure at the body part based on a force value measured by the force sensor when the blood signal reaches a second pre-determined value.

The present invention relates to methods of diagnosing preeclampsia in a subject based on the quantitative level of one or more biomarkers in a sample from the subject. Also disclosed are methods of treating the subject diagnosed with preeclampsia.

A system includes a first sensor to generate a swelling signal based on a user pressing the first sensor with a body part, a second sensor to generate a blood signal indicative of a volume of blood in the body part when the user presses the first sensor, and a force sensor to measure a force applied to the first sensor by the body part when the user presses the first sensor. The system also includes a processor configured to determine an indication of swelling of the body part based on the swelling signal when the force sensor measures a first predetermined value, and determine an indication of blood pressure at the body part based on a force value measured by the force sensor when the blood signal reaches a second predetermined value.

A wearable electronic system for the multi-modal monitoring and early detection of pre-eclampsia is disclosed. The system comprises a wristworn computing platform and a wirelessly coupled abdominal sensor unit. The wrist-worn device integrates a full-color touchscreen display (16); a rotary encoder (22) employing a Hall-effect sensor and a conductive crown surface (27) functioning as an ECG reference electrode; and a biometric sensor cluster comprising a four-photodiode optical array (17), a multi-wavelength LED array (21), a SioZ / ECG electrode assembly (19), and a skin-surface temperature sensor (18), all interfaced to a unified analog front-end (30). A central multi-core microcontroller unit (28), supported by high-bandwidth PSRAM (37) and NOR-Flash (29), orchestrates real-time signal processing for cuffless blood pressure estimation. A hardware security module (45) ensures hardware-rooted encryption of all maternal and fetal biometric data. The abdominal sensor utilizes a piezoelectric transducer and microphone to capture fetal heart rate and uterine contractions, enabling consolidated clinical-grade surveillance and automated risk classification for hypertensive disorders during pregnancy.