Preparation method of anti-human Nogo-66 receptor protein vaccine and application thereof
A nogo-66, receptor protein technology, applied in the treatment of spinal cord injury repair, the field of preparation of anti-human Nogo-66 receptor protein vaccine, to achieve the effect of promoting functional recovery, promoting regeneration, and reducing tissue necrosis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Cloning, protein expression and purification of embodiment 1, human NgR gene
[0033] From human neuroblastoma (SK-N-SH) cDNA, the full-length hNgR gene (excluding signal peptide) was amplified by PCR. The primers used are as follows:
[0034] Upstream primer: 5′-TT GGATCC TGCCCAGGTGCCTGCGTATG;
[0035] Downstream primer: 5′-TT AAGCTT CAGCAGGGCCCAAGCACTGTC;
[0036]The upstream primer contains a BamHI site, and the downstream primer contains a HindIII site and a stop codon. The amplified fragment was inserted into the cloning vector pUC19, and then subcloned into the expression vector pET28a(+) containing 6 His tags to obtain the recombinant expression plasmid pET28a-NgR. After enzyme digestion and sequencing, the recombinant plasmid was transformed into Escherichia coli expression strain BL21(DE3) for induced expression, and the expressed target protein was identified by SDS-PAGE and Western Blot. Finally, the target protein was purified by Ni-NTA affinity purif...
Embodiment 2
[0038] Embodiment 2, animal immunization and antibody detection
[0039] SD rats (n=20) were immunized with purified NgR protein as antigen. For the initial immunization, each rat was injected with 50 μg antigen plus complete Freund's adjuvant (FCA, Sigma Company) subcutaneously at multiple points on the back and subcutaneously on the hind paw. Afterwards, a booster immunization was carried out every 2w. During the booster immunization, each rat was subcutaneously injected with 50 μg antigen plus incomplete Freund's adjuvant (FIA, Sigma company) at multiple points on the back, and the control group replaced the antigen with an equal volume of PBS. Immunized (n=15). After boosting immunization for 3 times, the serum was separated by eyeball blood collection and the antibody titer was detected by ELISA method. The method is as follows: first, dilute the purified NgR antigen with 0.05M carbonate buffer (pH 9.6) and coat the microtiter plate with 100 μl / well (containing 50 μg an...
Embodiment 3
[0041] Embodiment 3, neurite outgrowth test
[0042] Separate the cerebellum of P7-9 day rats and place them in D-Hanks solution, peel off the meninges, and cut the tissue into 1-2mm 3 The small pieces were digested with digestion solution (D-Hanks solution containing 0.25% trypsin) in a 37°C incubator for 10-12min, and then the reaction was terminated with DMEM culture solution containing 10% fetal bovine serum. Repeated blowing and blowing to obtain the cell suspension, centrifuged at 1500 rpm for 3 minutes, discarded the supernatant, washed the precipitated cells twice with D-Hanks solution, and isolated and purified cerebellar neurons by step-by-step adherent culture method, namely Suspend the cells isolated from the cerebellum in DMEM medium containing 10% fetal bovine serum, inoculate them on a culture dish not covered with poly-lysine, and incubate them for 5 minutes, absorb the unattached cells, and discard the Adherent cells are mainly some fibroblasts and some astro...
PUM
| Property | Measurement | Unit |
|---|---|---|
| thickness | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 
