Preparation method of anti-human Nogo-66 receptor protein vaccine and application thereof

A nogo-66, receptor protein technology, applied in the treatment of spinal cord injury repair, the field of preparation of anti-human Nogo-66 receptor protein vaccine, to achieve the effect of promoting functional recovery, promoting regeneration, and reducing tissue necrosis

Inactive Publication Date: 2008-10-22
SHANGHAI JIAOTONG UNIV SCHOOL OF MEDICINE
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the use of its receptor NgR as an immunogen has not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of anti-human Nogo-66 receptor protein vaccine and application thereof
  • Preparation method of anti-human Nogo-66 receptor protein vaccine and application thereof
  • Preparation method of anti-human Nogo-66 receptor protein vaccine and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Cloning, protein expression and purification of embodiment 1, human NgR gene

[0033] From human neuroblastoma (SK-N-SH) cDNA, the full-length hNgR gene (excluding signal peptide) was amplified by PCR. The primers used are as follows:

[0034] Upstream primer: 5′-TT GGATCC TGCCCAGGTGCCTGCGTATG;

[0035] Downstream primer: 5′-TT AAGCTT CAGCAGGGCCCAAGCACTGTC;

[0036]The upstream primer contains a BamHI site, and the downstream primer contains a HindIII site and a stop codon. The amplified fragment was inserted into the cloning vector pUC19, and then subcloned into the expression vector pET28a(+) containing 6 His tags to obtain the recombinant expression plasmid pET28a-NgR. After enzyme digestion and sequencing, the recombinant plasmid was transformed into Escherichia coli expression strain BL21(DE3) for induced expression, and the expressed target protein was identified by SDS-PAGE and Western Blot. Finally, the target protein was purified by Ni-NTA affinity purif...

Embodiment 2

[0038] Embodiment 2, animal immunization and antibody detection

[0039] SD rats (n=20) were immunized with purified NgR protein as antigen. For the initial immunization, each rat was injected with 50 μg antigen plus complete Freund's adjuvant (FCA, Sigma Company) subcutaneously at multiple points on the back and subcutaneously on the hind paw. Afterwards, a booster immunization was carried out every 2w. During the booster immunization, each rat was subcutaneously injected with 50 μg antigen plus incomplete Freund's adjuvant (FIA, Sigma company) at multiple points on the back, and the control group replaced the antigen with an equal volume of PBS. Immunized (n=15). After boosting immunization for 3 times, the serum was separated by eyeball blood collection and the antibody titer was detected by ELISA method. The method is as follows: first, dilute the purified NgR antigen with 0.05M carbonate buffer (pH 9.6) and coat the microtiter plate with 100 μl / well (containing 50 μg an...

Embodiment 3

[0041] Embodiment 3, neurite outgrowth test

[0042] Separate the cerebellum of P7-9 day rats and place them in D-Hanks solution, peel off the meninges, and cut the tissue into 1-2mm 3 The small pieces were digested with digestion solution (D-Hanks solution containing 0.25% trypsin) in a 37°C incubator for 10-12min, and then the reaction was terminated with DMEM culture solution containing 10% fetal bovine serum. Repeated blowing and blowing to obtain the cell suspension, centrifuged at 1500 rpm for 3 minutes, discarded the supernatant, washed the precipitated cells twice with D-Hanks solution, and isolated and purified cerebellar neurons by step-by-step adherent culture method, namely Suspend the cells isolated from the cerebellum in DMEM medium containing 10% fetal bovine serum, inoculate them on a culture dish not covered with poly-lysine, and incubate them for 5 minutes, absorb the unattached cells, and discard the Adherent cells are mainly some fibroblasts and some astro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
thicknessaaaaaaaaaa
Login to view more

Abstract

The invention provides a method for preparing antihuman Nogo-66 receptor protein vaccine. An hNgR gene in full size is obtained by the PCR amplification from human neurobalstoma (SK-N-SH) cDNA. The amplified segment is inserted in a cloning vector and is sub-cloned to an expression vector pET28a (+) containing six His labels to obtain a recombinant expression plasmid pET28a-NgR. The recombinant plasmid is transformed into a coli expression strain BL21 (DE3) for the induced expression to obtain hNgR protein. By closing the effect of NgR and blocking the effect of inhibitory factor, the NgR protein vaccine can promote the regeneration of neurons axon after the spinal cord injury, can reduce the tissue necrosis in a damage zone, can promote the functional recovery of the injured spinal cord and express that the NgR protein vaccine is provided with a potential value for treating the spinal cord injury. The defect that exogenous biological agent can be easily eliminated by an autoimmune system is avoided. In addition, the characters that the cellular immunity is mainly induced after the DNA vaccination of NgR and only few individuals can induce humoral immunity are overcome.

Description

technical field [0001] The invention relates to the preparation of a protein vaccine, in particular to a preparation method of an anti-human Nogo-66 receptor (NgR) protein vaccine and its application in repairing spinal cord injury. Background technique [0002] There are mainly three kinds of axon regeneration inhibitory molecules derived from myelin that have been discovered so far: Nogo-A, MAG and OMgp. These three proteins with distinct molecular structures share a common receptor, Nogo-66 receptor (NgR). NgR can bind to these three inhibitory molecules with high affinity and transduce the signal of inhibiting axon regeneration into the cell. [0003] Researchers have used spinal cord homogenate or myelin sheath extracts to immunize animals to treat spinal cord injury (Spinal Cord Injury, SCI), and the results show that the immune body can block its inhibitory effect by producing antibodies against inhibitory molecules, thereby promoting animal immunity. Restoration of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/395A61P25/00C12N15/09C12N15/12
Inventor 陆佩华于盼盼黄立东徐晓明虞志华王艳霞王小飞刘欣秋徐亮
Owner SHANGHAI JIAOTONG UNIV SCHOOL OF MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap