Sucrose isomerase gene and high-efficiency expression method thereof

A sucrose isomerase and high-efficiency expression technology is applied in the field of sucrose isomerase gene and its high-efficiency expression, and achieves the effects of high-efficiency expression, short induction time, convenient use and low cost

Inactive Publication Date: 2010-12-08
NANJING UNIV OF TECH
View PDF1 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In China, the cloning and expression of SIase has been rarely reported so far, and the limited research in China is still mainly devoted to improving the enzyme production of the original strain

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sucrose isomerase gene and high-efficiency expression method thereof
  • Sucrose isomerase gene and high-efficiency expression method thereof
  • Sucrose isomerase gene and high-efficiency expression method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Extraction of total DNA from Erwinia rhapontici NX-5.

[0032]E.rhapontici NX-5 strain (CCTCC NO: 2222) was cultured in SB liquid medium (peptone 10g / L, yeast extract 5g / L, NaCl 10g / L) for 12h, collected by centrifugation at 8000r / min, sterile water Wash, collect and suspend the precipitate in 500 μL Tris-EDTA (trishydroxymethylaminomethane-ethylenediaminetetraacetic acid) buffer, add 5 μL RNase, incubate at 37 °C for 30 min, add 30 μL 10% SDS (sodium dodecyl sulfate) and 15 μL of proteinase K, incubated at 37°C for 60 min, added 100 μL of 5M NaCl solution and 80 μL of CTAB (cetyltrimethylammonium bromide), incubated at 65°C for 20 min, and added 700 μL of phenol: chloroform: isoamyl alcohol Extract the mixed solution with a ratio of 25:24:1, centrifuge at 10,000 r / min, extract the supernatant with 700 μL of chloroform:isoamyl alcohol with a volume ratio of 24:1, centrifuge at 10,000 r / min, and centrifuge the supernatant with 1,400 μL of ice isoamyl alcohol ...

Embodiment 2

[0033] Example 2: Cloning of the gene encoding SIase.

[0034] The E.rhapontici NX-5 total DNA obtained in Example 1 is used as a template, and the following nucleotide sequences are used as primers:

[0035] Primer 1: TT AAGCTT CCATGG ATTTCTCAAGGATT, respectively introduced HindIII, NcoI restriction sites (underlined part).

[0036] Primer 2: GTAAATATTTTGAATTAGGC GAGCTC CCTAGG TT, respectively introduce BamH I and Xho I double restriction sites (underlined part).

[0037] The PCR reaction was carried out in a 20 μL system: 2 μL of 10×PCR buffer, 2 μL of 2.5 mmol / LdNTP, 2 μL of 10 μmol / L primer 1 and primer 2, 2 μL of template DNA, 25 mmol / L MgCl 2 2 μL, TaqDNA polymerase 1 μL, add double distilled water to 20 μL.

[0038] PCR reaction conditions: Denaturation at 95°C for 3 minutes, and then cycle, (94°C for 30s; 45°C for 30s; 72°C for 2min; 72°C for 5min), a total of 25 cycles, amplified to obtain a 1800bp PCR fragment, cut the gel and recover, and recover the frag...

Embodiment 3

[0039] Example 3: Construction of pal I gene on expression vector.

[0040] The plasmid used to construct the expression vector is pET22b(+), with pelB signal peptide and His-tag marker. The pET22b(+) plasmid and pal I gene were digested with Xho I and Nco I double enzymes, the gel was cut to recover pal I, and then ligated with T4 ligase overnight at 16°C. The ligated product was transformed into E.coli BL21 (DE3) competent cells, and the Cultivate overnight at 37°C, select transformants and carry out liquid culture in LB of 100 μg / mL ampicillin, and then extract the plasmid to obtain the enriched pal I / pET22b(+) plasmid ( figure 1 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a sucrose isomerase gene, namely a pal I gene, which has the nucleotide sequence shown as SEQ ID NO:1. The invention also discloses a coding protein for the gene, namely an SIase enzyme. The invention also discloses an expression vector and a host cell containing the gene, and a high-efficiency expression method for the gene. A recombinant strain containing the sucrose isomerase gene has isomerism activity and can transform sucrose into isomaltulose. The recombinant strain has the advantages of high stability, high catalytic efficiency, obvious improvement of product specificity, and application to industrial production of the isomaltulose.

Description

technical field [0001] The invention belongs to the fields of genetic engineering and enzyme engineering, and in particular relates to a sucrose isomerase gene and a high-efficiency expression method thereof. Background technique [0002] Sucrose isomerase (SIase for short) is a key enzyme for the production of functional sweeteners isomaltulose (alcohol) and trehalulose. Isomalt is a functional sugar alcohol emerging in recent years, which is produced by hydrogenation of isomaltulose through nickel catalysis. In addition to the common characteristics of general sugar alcohols, it also has extremely low hygroscopicity and pure taste that functional sugar alcohols such as xylitol and maltitol cannot match. Due to its unique properties, it has been welcomed by the food industry to produce sugar-free sweet foods. Especially in recent years, with people's emphasis on their own health, the production, development and utilization of isomalt have received widespread attention. It...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/61C12N9/90C12N15/63C12N1/21C12P19/12C12R1/19
Inventor徐虹李莎任贲蔡恒汪晨
OwnerNANJING UNIV OF TECH