Recombinant Salmonella choleraesuis for expressing surface antigen gene sao of streptococcus suis type 2, vaccine and application
A surface antigen gene, Streptococcus suis technology, applied in the direction of bacterial antigen composition, application, genetic engineering, etc., can solve the problems of low immune efficacy and large side effects, and achieve the effect of good biological safety and good immune protection.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1 Salmonella choleraesuis asd gene deletion strain asd - Construction of the C500
[0040] 1. Primer Design
[0041] With reference to the reported asd gene sequence of Salmonella typhimurium LT2 strain (GenBank No: AE008863), 2 pairs of primers (pa1 / pa2 and pa3 / pa4, see Table 1) were designed from the Salmonella choleraesuis attenuated vaccine strain C500 (purchased from China Veterinary Drug Supervision The upstream and downstream fragments asd1 and asd2 of the asd gene were respectively amplified in the genome of the Institute), and the sizes of the amplified fragments were 2112bp and 2069bp, respectively. XbaI and BamHI restriction sites were introduced at both ends of the upper arm, and BamHI and KpnI were respectively introduced at both ends of the lower arm. Restriction sites. Another pair of primers (see Table 1 for pa5 / pa6) were designed to identify the C500 parent strain and asd-deficient strain. The primers were synthesized by Shanghai Sangon Bioengi...
Embodiment 2
[0052] Embodiment 2: Cloning of Streptococcus suis type 2 surface antigen gene sao
[0053] 1. Gene analysis and primer design
[0054] Refer to the reported sao gene sequence of Streptococcus suis type 2 05ZYH33 strain (genebank NO.CP000407); use Tmpred (http: / / www.ch.emnet..org / software / tmpred_Form.html) and SignalP (http: / / www .cbs.dtu.dk / services / SignalP / ) software to analyze the amino acid sequence of the protein encoded by the gene; design the upstream primer AAAGGATCCGCAACCTGATGGGGGAC and the downstream primer GGGCTGCAGTCATTACATTGCTTCCTTA to amplify the segment A of the sao gene (saoA, 777bp). Primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. The position of sao gene in 05ZYH33 strain in genbank is as follows Figure 5 shown.
[0055] The full-length sao gene of Streptococcus suis type 2 strain 05ZYH33 (genebank NO. CP000407) is 1743bp, encoding 581 amino acids. The amino acid sequence of Sao protein was analyzed using Tmpred and SignalP software,...
Embodiment 3
[0074] Embodiment 3: Construction of prokaryotic expression plasmid pYA-saoA
[0075] 1. TA cloning of the saoA fragment of the surface antigen gene of Streptococcus suis
[0076] The PCR recovery product of the target gene saoA and the vector pMD18-T (purchased from Treasure Bioengineering (Dalian) Co., Ltd.) were ligated in a water bath at 16°C overnight to transform DH5α competent cells. / mL) of LB solid medium, from which a number of single colonies were randomly selected, respectively placed in LB liquid medium containing ampicillin (AMP, 50 μg / mL) and cultured at 37°C for 12 hours to extract plasmids from them. After cutting and identification, a positive recombinant plasmid was screened, which was named pMD-saoA. The pMD18-T plasmid map is as follows Figure 7 shown.
[0077] 2. Preparation of competent state of χ6097 (CaCl 2 Law)
[0078] Using CaCl 2 Escherichia coli χ6097 (araΔ(lac-pro)rpslΔasdA4Δ[zhf-2::Tn10]thiΦ580d / lacZΔM15, donated by Dr. Roy Curtiss III, U...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 