Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant Salmonella choleraesuis for expressing surface antigen gene sao of streptococcus suis type 2, vaccine and application

A surface antigen gene, Streptococcus suis technology, applied in the direction of bacterial antigen composition, application, genetic engineering, etc., can solve the problems of low immune efficacy and large side effects, and achieve the effect of good biological safety and good immune protection.

Active Publication Date: 2011-02-23
HUAZHONG AGRI UNIV +1
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Vaccine immunization is one of the most effective strategies to control the disease. Although inactivated vaccines can effectively control the infection of homologous strains, there are problems such as low immune efficacy and large side effects. Therefore, it is urgent to develop a new type of Streptococcus suis vaccine , genetically engineered vector vaccines are considered to be one of the effective strategies to control the disease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant Salmonella choleraesuis for expressing surface antigen gene sao of streptococcus suis type 2, vaccine and application
  • Recombinant Salmonella choleraesuis for expressing surface antigen gene sao of streptococcus suis type 2, vaccine and application
  • Recombinant Salmonella choleraesuis for expressing surface antigen gene sao of streptococcus suis type 2, vaccine and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Salmonella choleraesuis asd gene deletion strain asd - Construction of the C500

[0040] 1. Primer Design

[0041] With reference to the reported asd gene sequence of Salmonella typhimurium LT2 strain (GenBank No: AE008863), 2 pairs of primers (pa1 / pa2 and pa3 / pa4, see Table 1) were designed from the Salmonella choleraesuis attenuated vaccine strain C500 (purchased from China Veterinary Drug Supervision The upstream and downstream fragments asd1 and asd2 of the asd gene were respectively amplified in the genome of the Institute), and the sizes of the amplified fragments were 2112bp and 2069bp, respectively. XbaI and BamHI restriction sites were introduced at both ends of the upper arm, and BamHI and KpnI were respectively introduced at both ends of the lower arm. Restriction sites. Another pair of primers (see Table 1 for pa5 / pa6) were designed to identify the C500 parent strain and asd-deficient strain. The primers were synthesized by Shanghai Sangon Bioengi...

Embodiment 2

[0052] Embodiment 2: Cloning of Streptococcus suis type 2 surface antigen gene sao

[0053] 1. Gene analysis and primer design

[0054] Refer to the reported sao gene sequence of Streptococcus suis type 2 05ZYH33 strain (genebank NO.CP000407); use Tmpred (http: / / www.ch.emnet..org / software / tmpred_Form.html) and SignalP (http: / / www .cbs.dtu.dk / services / SignalP / ) software to analyze the amino acid sequence of the protein encoded by the gene; design the upstream primer AAAGGATCCGCAACCTGATGGGGGAC and the downstream primer GGGCTGCAGTCATTACATTGCTTCCTTA to amplify the segment A of the sao gene (saoA, 777bp). Primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. The position of sao gene in 05ZYH33 strain in genbank is as follows Figure 5 shown.

[0055] The full-length sao gene of Streptococcus suis type 2 strain 05ZYH33 (genebank NO. CP000407) is 1743bp, encoding 581 amino acids. The amino acid sequence of Sao protein was analyzed using Tmpred and SignalP software,...

Embodiment 3

[0074] Embodiment 3: Construction of prokaryotic expression plasmid pYA-saoA

[0075] 1. TA cloning of the saoA fragment of the surface antigen gene of Streptococcus suis

[0076] The PCR recovery product of the target gene saoA and the vector pMD18-T (purchased from Treasure Bioengineering (Dalian) Co., Ltd.) were ligated in a water bath at 16°C overnight to transform DH5α competent cells. / mL) of LB solid medium, from which a number of single colonies were randomly selected, respectively placed in LB liquid medium containing ampicillin (AMP, 50 μg / mL) and cultured at 37°C for 12 hours to extract plasmids from them. After cutting and identification, a positive recombinant plasmid was screened, which was named pMD-saoA. The pMD18-T plasmid map is as follows Figure 7 shown.

[0077] 2. Preparation of competent state of χ6097 (CaCl 2 Law)

[0078] Using CaCl 2 Escherichia coli χ6097 (araΔ(lac-pro)rpslΔasdA4Δ[zhf-2::Tn10]thiΦ580d / lacZΔM15, donated by Dr. Roy Curtiss III, U...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of animal bacterium gene engineering, and in particular relates to construction of resistance marker-free recombinant Salmonella choleraesuis for expressing surface antigen sao gene segment of streptococcus suis type 2, preparation of a vaccine and application. The resistance marker-free recombinant Salmonella choleraesuis for expressing the surface antigen sao gene segment of the streptococcus suis type 2, namely asd-C500 / Pya-saoA is obtained, and the collection number is CCTCC NO: M2010156. The asd gene of the Salmonella choleraesuis is deleted in the recombinant strain, and the recombinant strain contains plasmid pYA-saoA capable of expressing the asd and the sao gene segment of the streptococcus suis type 2. The invention also discloses a method for preparing the recombinant strain and the vaccine, and application in preparing Salmonella choleraesuis-streptococcus suis type 2 vaccines.

Description

technical field [0001] The invention belongs to the field of genetic engineering of animal bacteria, and in particular relates to the construction, vaccine preparation and application of a recombinant Salmonella choleraesuis strain expressing the SAO fragment of the surface antigen gene of Streptococcus suis type 2 without a resistance marker. Background technique [0002] Streptococcus suis (S. suis) is an important pathogen that endangers the pig industry today, and is the main pathogen that causes suis streptococcosis. It is also often used as the concurrent or secondary infection pathogen of swine fever, porcine blue ear disease, porcine circovirus disease, porcine eperythrozoon, porcine infectious pleuropneumonia, etc., seriously endangering the development of pig industry in my country and even the world. Among them, Streptococcus suis serotype 2 (SS2) is highly pathogenic and widespread, and it is also the serotype with the highest frequency of clinical isolation in r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/09C12N15/31A61K39/112C12N15/74A61K39/116A61P31/04C12N1/21C12R1/42
Inventor 金梅林石建陈焕春黄灿辉康超郭爱珍徐高原吴斌
Owner HUAZHONG AGRI UNIV