Novel helicobacter pylori multiepitope vaccine and preparation method thereof

A Helicobacter pylori, multi-epitope technology, applied in the field of biomedicine, can solve problems such as the increase of Hp drug-resistant strains, toxic and side effects, and long treatment cycles

Inactive Publication Date: 2011-09-14
CHINA PHARM UNIV
View PDF3 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are many disadvantages in the "triple" drug therapy: (1) The widespread use of antibiotics has led to an increasing number of Hp drug-resistant strains, and the efficacy of drugs is declining. It is still difficult to completely cure it with the simultaneous use of 2 or 3 antibiotics clinically
(2) There are toxic and side effects of therapeutic drugs
(3) Drug treatment is difficult to avoid the embarrassing situation of "repeated treatment, repeated infection"
(4) The drug is expensive, the treatment cycle is long, and the patient's compliance is poor
In addition, experimental studies have also proved that the anti-urease antibody stimulated by natural Hp urease cannot effectively inhibit the activity of urease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel helicobacter pylori multiepitope vaccine and preparation method thereof
  • Novel helicobacter pylori multiepitope vaccine and preparation method thereof
  • Novel helicobacter pylori multiepitope vaccine and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0060] Example 1: The molecular structure design of the multi-epitope vaccine CTB-UE of Helicobacter pylori

[0061] According to "the body's immune protection mechanism against Hp" and "the immunological properties of urease epitope", select urease Th and B cell epitope UreA 74-90 , UreB 229--251 , UreA 183-203 And UreB 327-334 For the construction of a new type of Hp multi-epitope vaccine. In the design of the new Hp multi-epitope peptide vaccine, this research group put Th cell epitopes at the front of B cell epitopes, which helps the effective presentation of B cell epitopes, and then passes bioinformatics DNAstar and RANKPEP software Analysis and evaluation, the epitope sequence is determined as UreAB 74-90 -UreBB 229-251B -UreAB 183-203B -UreBB 327-334B ; Select KK as the spacer sequence of the adjacent urease Th epitope, and select GS as the spacer sequence of the adjacent urease B epitope; add the urease epitope UreA 74-79 , UreB 229-244 , UreB 237-251 And UreA 183-203 Cop...

example 2

[0063] Example 2: Construction of recombinant expression vector pETCUE (containing the fusion gene CTB-UE)

[0064] (1) Construction of recombinant expression vector pETC (containing cholerarin B subunit gene)

[0065] Using the recombinant vector pETCtUBE (gifted by Professor Wu Wutong) as a template, primers P1-CTB and P2-CTB were designed using Primer Premier V5.0. The sequences and characteristics of primers P1-CTB and P2-CTB are as follows:

[0066] Primer P1-CTB: CATGU CCATGG UGCACACCTCAAAATATTACTGATTTGTGTGC;

[0067] Primer P2-CTB:

[0068] CCCU AAGCTT U CU GGTACC CGCGGATCATTTGCCATACTAATTGCGGCAATC;

[0069] Primer P1-CTB has a Nco I restriction site (CCATGG) at the front end, which is underlined; primer P2 has a Hind III (AAGCTT) and KpnI (GGTACC) restriction site and part of the Linker at the front end, and the restriction site is underlined Mark, Linker is shaded. The primers were synthesized by Nanjing Jinsirui Biotechnology Company. The reaction system for amplifying ...

example 3

[0084] Example 3: Prokaryotic expression of urease multi-epitope peptide fusion protein CTB-UE

[0085] The correct recombinant expression plasmid pETCUE was transformed into E.coli BL21(DE3) strain. On a pre-prepared LB plate containing 50μg / mL Amp, inoculate the genetically engineered strain pETCUE / BL21(DE3) with a circular streak, and place it upside down in a 37°C incubator. After overnight incubation for 12-16 hours, pick a single colony and inoculate it in In LB medium containing 50μg / mL Amp, culture at 37°C and 180rpm for 12-16h. Inoculate the recombinant bacteria in LB medium containing 50μg / mL Amp with 2% inoculum, shake overnight at 37°C and 180rpm, and then inoculate the bacteria liquid with 1% inoculation amount into LB liquid containing 50μg / mL Amp in the morning. After shaking the flask at 37°C and 180rpm for 3h in the culture medium, IPTG was added to make the final concentration reach 1mmol / L, 37°C and 180rpm to induce expression, and the empty vector bacteria pE...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a helicobacter pylori multiepitope vaccine. The active ingredient of the helicobacter pylori multiepitope vaccine is a piece of polypeptide; and the helicobacter pylori multiepitope vaccine mainly comprises a multi-copy body of Th and B cell antigen epitopes of helicobacter pylori urease A and B bi-subunit and a mucosal immune adjuvant of a cholera toxin B subunit. The preparation method mainly comprises the following steps of: synthesizing an artificial gene by using a gene synthesis technology, wherein the artificial gene comprises a gene sequence of the multi-copy body of the Th and B cell antigen epitopes of the helicobacter pylori urease A and B bi-subunit; coupling the artificial gene with the gene sequence of the cholera toxin B subunit to form a fusion gene;and expressing the fusion gene by using an escherichia coli prokaryotic expression system, and performing protein purification to obtain the helicobacter pylori multiepitope vaccine. The helicobacterpylori multiepitope vaccine can induce an organism to generate T cell immune response and high-titred specific antibody humoral immune response aiming at the urease A and B bi-subunit, and can be used for preventing and treating helicobacter pylori infection related diseases.

Description

Technical field [0001] The invention belongs to the field of biomedicine, and specifically relates to a novel Helicobacter pylori multi-epitope vaccine and its preparation method and application. Background technique [0002] Helicobacter pylori (Hp) is an important pathogenic factor of chronic gastritis, peptic ulcer and duodenal ulcer, and is closely related to gastric cancer. The World Health Organization (WHO) has listed Hp as a Class I carcinogen. The infection rate of Helicobacter pylori is very high, the Hp infection rate of the world population exceeds 50%, and the Hp infection rate of the Chinese population is 58.07%, showing family clustering, and the situation is more severe. The current treatment of Hp infection is mainly based on "triple" drug therapy, the main components of which are proton pump inhibitors, antibiotics and bismuth agents. The "triple" drug therapy has many disadvantages: (1) The widespread use of antibiotics has led to an increasing number of resis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K39/02C12N15/70C07K19/00C07K1/18A61P31/04A61P1/04C12R1/19
Inventor奚涛郭乐邢莹莹何赟绵李小康
OwnerCHINA PHARM UNIV