Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Thermus siphoviridae phage 4 (TSP4) DNA helicase and polynucleotide coding same

A DNA helicase and polynucleotide technology, applied in the biological field, can solve the problems of poor stability and heat resistance, affecting the efficiency of PCR reaction, etc., so as to improve the efficiency, improve the melting efficiency, and improve the amplification efficiency. Effect

Inactive Publication Date: 2012-01-04
KUNMING UNIV OF SCI & TECH
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since most of the helicases expressed by clones are from normal temperature microorganisms, their stability and heat resistance are not very good, which affects the reaction efficiency of PCR. an important avenue of the problem

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Thermus siphoviridae phage 4 (TSP4) DNA helicase and polynucleotide coding same
  • Thermus siphoviridae phage 4 (TSP4) DNA helicase and polynucleotide coding same
  • Thermus siphoviridae phage 4 (TSP4) DNA helicase and polynucleotide coding same

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0031] Example 1: Cloning and expression of a DNA helicase

[0032] 1. Amplification of TSP4 phage DNA helicase gene (using phage TSP4DNA as template)

[0033] (1) The primer sequences used for amplification of TSP4 phage DNA helicase gene are as follows:

[0034] Forward primer: 5'- CATATG ACGGACATAAAGCTGGAG -3'

[0035] Reverse primer: 5'- CTCGAG GGTAAGAGAGAAATCAAAGTT -3'

[0036] (2) The amplification system is as follows:

[0037] Table 1: Amplification reaction system components

[0038] template 10ng Premix exTaq 25 μl Primer 1 μl each Double distilled water ddH 2 o Replenish to 50 μl

[0039] (3) The amplification conditions are as follows:

[0040] Mix the reaction system evenly, pre-denature at 94°C for 4 min, then denature at 94°C for 30 s, anneal at 60°C for 30 s, extend at 72°C for 30 s, and after 30 cycles, extend at 72°C for 10 min. After the reaction, 5 μl of the product was taken and analyzed by electrophoresis in...

Embodiment 2

[0118] Embodiment 2 Determination of the ATPase Enzyme Activity of Recombinant Helicase Protein

[0119] The method of ATPase enzyme activity is determined by malachite green ammonium molybdate method. When ATP is hydrolyzed into ADP by helicase and free phosphate is released, blue complexes can be produced with molybdate. By measuring the absorbance, it can be determined Its ATPase enzymatic activity, the method is as follows:

[0120] The preparation method of malachite green dye stock solution was as follows: 60 mL of concentrated sulfuric acid (1.84 g / mL) was slowly added to 300 mL of H 2 O, cooled to room temperature, and added 0.44 g malachite green dye.

[0121] The sample is: 1 for buffer + dsDNA + ATP + Mg 2+ (blank control), 2 is recombinant tsp4-h42 helicase + ATP, 3 is recombinant tsp4-h42 helicase + dsDNA + ATP, 4 is recombinant tsp4-h42 helicase + dsDNA + ATP + Mg 2+ .

[0122] The reaction mixture (200 μl) for the determination of ATPase activity contains ...

example 3

[0125] Example 3 Measurement of helicase activity by isotope labeling

[0126] 1. For the measurement principle see figure 1 .

[0127] 2. Detwisted template preparation

[0128] a. Using T4 polynucleotide kinase (Takara) and [γ- 32 P] ATP marks the 3' sequence of the synthetic primer sequence p42, and the p42 primer sequence is:

[0129] 5'-CAGTGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGA

[0130] b. The p42 labeled with the radioactive isotope is annealed with the genome of the M13 phage to form a partial double strand.

[0131] c. Annealing to form a labeled unwrapped template:

[0132] The annealing process is as follows: boil the corresponding primer and template in the annealing buffer (20 mM Tris-HCl, pH 7.5, 100 mM NaCl) at a ratio of 1:1.5 for 3 min, and naturally cool to room temperature, usually 4 h, to form End-labeled DNA p42 / M13.

[0133] 3. Determination of helicase activity

[0134] The standard helicase activity assay system is 20 μl, and the reaction mixt...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses thermus siphoviridae phage 4 (TSP4) DNA helicase and a polynucleotide coding the same. The DNA helicase which is separated thermus siphoviridae phage 4 is critical in polymerase chain reaction (PCR) technique, and can improve the efficiency of the amplification of the DNA fragment by the PCR technique so as to improve the efficiency of amplification.

Description

technical field [0001] The invention relates to a bacteriophage TSP4 DNA helicase and a polynucleotide encoding the helicase, belonging to the field of biotechnology. Background technique [0002] Helicases, a class of enzymes that separate double strands of nucleic acid, are involved in most cellular pathways in all organisms. The core reaction it catalyzes is generally very conservative. Helicase decomposes nucleic acid double strands (DNA-DNA, DNA-RNA or RNA-RNA) accompanied by hydrolysis of nucleoside triphosphates (NTP, usually ATP). Helicases are involved in most nucleic acid metabolic processes in cells, including chromosome and plasmid replication, transcription, translation, DNA recombination repair, and RNA processing. There are many enzymes with helicase functions in organisms. In prokaryotes, at least 12 putative helicases have been identified in the genome of Escherichia coli; Genes account for more than 2% of the genome, so it can be speculated that helicas...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/14C12N15/55C12N15/63C12R1/92
Inventor 林连兵薛寒李秋鹏魏云林季秀玲张琦
Owner KUNMING UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com