Transgenic interference vector containing enhancer Hr3 and promotor IE1, as well as preparation method and application of transgenic transposition vector
An interference vector and transgene technology, which is applied in the direction of introducing foreign genetic material, DNA/RNA fragments, recombinant DNA technology using vectors, etc. It can solve the problems of constructing transgenic interference vectors and the inability of viruses to multiply, and achieves low risk of loss and preservation. And the management is convenient, the effect is good
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Example Embodiment
[0043] Example 1: Preparation of transgenic interference vector
[0044] The present invention uses BmNPV gp64 Take genes as target genes as an example to construct transgene interference vectors. Similarly, the present invention is not limited to using BmNPV gp64 Genes are used as target genes, and other reported or unreported genes can also be used.
[0045] With the reported BmNPV gp64 Gene sequence, design the forward fragment (gp64S) amplification primer gp64senseF: 5'ccggaattcccgattaaacgtaaagtcgagcacc 3', gp64senseR: 5'cgcggatccgcggggcaataaacgaccaacc 3', and the reverse fragment (gp64A) amplification primer gpaccggcaF: 5acggaccantiata: 5acgganticaR: 5ac 'tgctctagagcaattaaacgtaaagtcgagcacc 3'. Using the BmNPV virus genome as a template for PCR amplification, the PCR reaction conditions are: 94°C pre-denaturation for 4 minutes, then 94°C denaturation for 40 seconds, 52°C annealing for 40 seconds, and 72°C extension for 40 seconds, a total of 30 cycles, and finally 72 Exte...
Example Embodiment
[0051] Example 2: Transgenic microinjection and screening of positive individuals
[0052] After soaking the eggs of silkworm 932 species in acid (hydrochloric acid with specific gravity of 1.073, temperature of 46°C, time of 5 minutes), after release of diapause, they are placed in a dark environment at 15°C and 80% humidity for about 30 days until hatching. Collect the ant silkworms and place them in a standard environment (temperature: 25℃, humidity: 80%). After the moths are transformed, the female and male silkworm moths will be mated for 4 hours. The next step of microinjection;
[0053] Arrange the laid silkworm eggs neatly on a clean glass slide, and inject 97 932 silkworm eggs into the pb-IGG recombinant vector obtained in Example 1 and the helper plasmid A3H with an Eppendorf microinjector 2 hours after the silkworm eggs are laid. After sealing with non-toxic glue, place it in an environment of 25°C and 80% relative humidity to incubate for about 10 days. The 25 hatched...
Example Embodiment
[0054] Example 3: Resistance detection of transgenic system
[0055] One IGG positive moth pen, one AGG positive moth pen and a randomly selected HIGG positive moth pen obtained in Example 2 were reared in a single moth pen, and successively expanded.
[0056] Take the transgenic system IGG, HIGG, AGG and normal 932 varieties, and feed the BmNPV virus on a single head orally during the 3rd instar silkworm start period. 4 systems have 3 repeats, each with 100 silkworms, and each system Set up 3 non-challenging control areas, and count the mortality rate for 10 consecutive days.
[0057] Statistics on the mortality of IGG, HIGG AGG and normal 932 varieties. The resistance test result shows that when 3×10 5 When feeding at the dose of head, the mortality results are as follows figure 2 As shown, the transgenic system HIGG has the lowest mortality rate, specifically 49.06%, AGG has a mortality rate of 50.70%, IGG has a mortality rate of 76.62%, and 932 has a mortality rate of 62.91%....
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap