Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Transgenic interference vector containing enhancer Hr3 and promotor IE1, as well as preparation method and application of transgenic transposition vector

An interference vector and transgene technology, which is applied in the direction of introducing foreign genetic material, DNA/RNA fragments, recombinant DNA technology using vectors, etc. It can solve the problems of constructing transgenic interference vectors and the inability of viruses to multiply, and achieves low risk of loss and preservation. And the management is convenient, the effect is good

Active Publication Date: 2012-06-13
SOUTHWEST UNIVERSITY
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Existing research results have shown that if certain essential genes of the virus are destroyed, the virus will not be able to reproduce
At present, there is no report on the use of composition-inducible promoters to construct transgene interference vectors and prepare transgene interference systems for silkworm practical varieties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transgenic interference vector containing enhancer Hr3 and promotor IE1, as well as preparation method and application of transgenic transposition vector
  • Transgenic interference vector containing enhancer Hr3 and promotor IE1, as well as preparation method and application of transgenic transposition vector
  • Transgenic interference vector containing enhancer Hr3 and promotor IE1, as well as preparation method and application of transgenic transposition vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1: Preparation of transgenic interference vector

[0044] The present invention uses BmNPV gp64 Take genes as target genes as an example to construct transgene interference vectors. Similarly, the present invention is not limited to using BmNPV gp64 Genes are used as target genes, and other reported or unreported genes can also be used.

[0045] With the reported BmNPV gp64 Gene sequence, design the forward fragment (gp64S) amplification primer gp64senseF: 5'ccggaattcccgattaaacgtaaagtcgagcacc 3', gp64senseR: 5'cgcggatccgcggggcaataaacgaccaacc 3', and the reverse fragment (gp64A) amplification primer gpaccggcaF: 5acggaccantiata: 5acgganticaR: 5ac 'tgctctagagcaattaaacgtaaagtcgagcacc 3'. Using the BmNPV virus genome as a template for PCR amplification, the PCR reaction conditions are: 94°C pre-denaturation for 4 minutes, then 94°C denaturation for 40 seconds, 52°C annealing for 40 seconds, and 72°C extension for 40 seconds, a total of 30 cycles, and finally 72 Exte...

Embodiment 2

[0051] Example 2: Transgenic microinjection and screening of positive individuals

[0052] After soaking the eggs of silkworm 932 species in acid (hydrochloric acid with specific gravity of 1.073, temperature of 46°C, time of 5 minutes), after release of diapause, they are placed in a dark environment at 15°C and 80% humidity for about 30 days until hatching. Collect the ant silkworms and place them in a standard environment (temperature: 25℃, humidity: 80%). After the moths are transformed, the female and male silkworm moths will be mated for 4 hours. The next step of microinjection;

[0053] Arrange the laid silkworm eggs neatly on a clean glass slide, and inject 97 932 silkworm eggs into the pb-IGG recombinant vector obtained in Example 1 and the helper plasmid A3H with an Eppendorf microinjector 2 hours after the silkworm eggs are laid. After sealing with non-toxic glue, place it in an environment of 25°C and 80% relative humidity to incubate for about 10 days. The 25 hatched...

Embodiment 3

[0054] Example 3: Resistance detection of transgenic system

[0055] One IGG positive moth pen, one AGG positive moth pen and a randomly selected HIGG positive moth pen obtained in Example 2 were reared in a single moth pen, and successively expanded.

[0056] Take the transgenic system IGG, HIGG, AGG and normal 932 varieties, and feed the BmNPV virus on a single head orally during the 3rd instar silkworm start period. 4 systems have 3 repeats, each with 100 silkworms, and each system Set up 3 non-challenging control areas, and count the mortality rate for 10 consecutive days.

[0057] Statistics on the mortality of IGG, HIGG AGG and normal 932 varieties. The resistance test result shows that when 3×10 5 When feeding at the dose of head, the mortality results are as follows figure 2 As shown, the transgenic system HIGG has the lowest mortality rate, specifically 49.06%, AGG has a mortality rate of 50.70%, IGG has a mortality rate of 76.62%, and 932 has a mortality rate of 62.91%....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the transgenic technology of bombyx mori, and mainly provides a transgenic interference vector containing enhancer Hr3 and a promotor IE1, as well as the preparation method and the application of the transgenic transposition vector. The base vector of the transgenic interference vector is a transposition vector pBac [3 * P3 - EGFPafm], and sequentially comprises the enhancer Hr3, the genic promotor IE1, a target gene forward segment, a bombyx mori actin Actin3 (A3) intron, a target gene reverse segment and a termination signal sequence SV40. Through the adoption of the technology, BmNPV virus can be inhibited as long as the BmNPV virus enters into a bombyx mori cell. In the invention, the promotor IE1 and the enhancer Hr3 are combined tactfully, so that a proper quantity of dsRNA can be expressed by transgenic bombyx mori in a normal condition; and when the BmNPV infests bombyx mori, protein IE1 produced during viral breeding can activate enhancer Hr3 to express a great quantity of dsRNA, so as to increase the expression quantity of the dsRNA of a target gene along with the increment of virus, which reduces impact of dsRNA expression on the normal physiological activities of bombyx mori, and obviously improve the resistance of bombyx mori.

Description

technical field [0001] The invention relates to the field of biological genes, in particular to the transgenic technology of silkworm. Background technique [0002] The silkworm is a Lepidoptera insect with important economic value. In many developing countries, sericulture is an important source of farmers' economic income. However, whenever sericulture encounters viruses, sericulture production will suffer irreparable huge losses. Bombyx mori nuclear polyhedrosis virus (BmNPV) is the most serious pathogen to sericulture. Existing research results have shown that if certain essential genes of the virus are destroyed, the virus will not be able to reproduce. Using transgenic technology to suppress the expression of key viral genes is an effective strategy for breeding disease-resistant silkworm varieties. [0003] RNA interference (RNAi) refers to the formation of double-stranded RNA (dsRNA) molecules by antisense RNA and positive-strand RNA, and shuts down or silences th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N15/113C12N15/66
Inventor 夏庆友蒋亮王根洪程廷才徐汉福
Owner SOUTHWEST UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com