Functional protein directional fixing method employing SLP
A directional immobilization and protein technology, applied in the field of protein immobilization, can solve the problems of non-directional protein molecules, complicated and severe operation, low activity utilization rate, etc., and achieve the effect of improving activity utilization rate, simple process and improving utilization rate.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] A method for directional immobilization of protein A to the surface of magnetic beads. Protein A is a protein present on the cell membrane surface of Staphylococcus aureus, which can specifically bind to the Fc segment of antibodies, and is widely used in the fields of antibody purification and immunoassay. In this example, the fusion expression of the SLP protein and the IgG binding domain (ZZ domain) of protein A is carried out. Specifically include the following steps:
[0055] (1) PCR amplification of the coding gene of SLP protein and protein A:
[0056] To amplify the SLP protein-encoding gene (see SEQ ID NO.7 for the sequence), the template uses the plasmid rSbpA-pUC19 (purchased from Nano-S Biotechnologie, Austria), and the primer pair (the primers already contain restriction enzyme sites) is as follows:
[0057] SLP primer 1: 5`AACCATGGCGCAAGTAAACGACTATAAC (Nco I);
[0058] SLP Primer 2: 5'AA GGATCCTTCTGAATATGCAGTAGTTG (BamHI).
[0059] Amplify the gene enc...
Embodiment 2
[0086] A method for directionally immobilizing protein A on the surface of a cell culture plate, the raw materials and preparation method of which are basically the same as in Example 1, except that the polystyrene cell culture plate is used instead of the magnetic beads wrapped in aminopolyethylene. The obtained polystyrene cell culture plate immobilized with SL-PA fusion protein can be used for immunoassay.
[0087] SL-PA fusion protein embedding human IgG binding ability verification test in cell culture plate:
[0088] 1) Add 200 mL of mouse anti-human IgG-HRP (1 μg / mL, Beijing Boster Company) to the culture wells of the SL-PA fusion protein-embedded cell culture plate, and shake at room temperature for 30 min. The culture wells in which the SL-PA fusion protein was replaced with water and bovine serum albumin (BSA at a concentration of 1 mg / mL, Sigma, USA) for the embedding experiment were used as negative controls.
[0089] 2) Wash the culture well twice with PBST buffe...
Embodiment 3
[0094] A method for directionally immobilizing streptavidin on the surface of magnetic beads (magnetic beads wrapped with aminopolyethylene, with a diameter of 200nm). Streptavidin is a tetrameric protein purified from Streptomyces avidinii, with a size of 52800Da; one molecule of streptavidin can bind to four molecules of biotin with high specificity, The affinity between the two is extremely strong, and the dissociation constant of the streptavidin-biotin complex is in the range of 10 15 M order of magnitude, this high affinity makes it widely used in molecular (DNA, protein) detection; including the following steps:
[0095] (1) PCR amplification of the coding genes of SLP and streptavidin:
[0096] The method and material for amplifying the SLP-encoding gene are the same as in Example 1 step (1);
[0097] Amplify the gene encoding streptavidin, the template sequence is SEQ ID NO.13, which was synthesized by Saiye Biotechnology Co., Ltd., using the following primer pairs ...
PUM
Property | Measurement | Unit |
---|---|---|
thickness | aaaaa | aaaaa |
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap