Dirofilaria immitis enzyme-linked immunosorbent assay (ELISA) kit and preparation method thereof
A detection kit and Dirofilaria immitis technology, applied in the field of canine disease detection, can solve the problems of low microfilaria detection sensitivity, high requirements for equipment and reagents, labor-intensive and other problems, and achieve long storage time of reagents, Low equipment requirements and fast detection results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Cloning of target gene
[0036] 1. According to the protective antigen gene MTFP gene sequence, design fragment amplification primers:
[0037] F2: 5'- GGATCC CAACTTACGCAGGAAGCA-3', the underline is the restriction site of BamH I;
[0038] S2: 5'- CTCGAG CTCGAGTTAGCAGTAATTGATGCC –3’, the Xho I restriction site is underlined.
[0039] 2. PCR amplification of the Dirofilaria immigatus MTFP gene
[0040] The PCR reaction system is: 5 μL of 10×buffer, 4 μL of dNTPs, 3 μL of DNA template, 0.5 μL of upstream primer and downstream primer, 0.5 μL of rTaq enzyme, and add water to 50 μL. Reaction conditions: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 2 min, annealing at 59°C for 1 min, extension at 72°C for 1 min, 30 cycles; final extension at 72°C for 10 min. The prepared phage genome containing the MTFP insert was amplified as a template. PCR products were identified by 1% agarose gel electrophoresis (see figure 1 ).
[0041] 3. Cloning of the gen...
Embodiment 2
[0055] Construction of recombinant expression vector
[0056] 1 Preparation of a large number of plasmids
[0057] Inoculate the recombinant bacteria transformed into DH5a with the correct recombinant cloning vector into Amp-containing LB liquid medium, culture in a 37°C incubator with shaking for 12 hours, and extract the plasmid with a large number of plasmid extraction kits from TaKaRa Company, according to the instructions.
[0058] 2. Gel recovery of enzyme-digested target gene
[0059] Add the following reagents in sequence: 2 μL restriction enzyme BamH I, 2 μL restriction enzyme Xho I, 41 μL DNA and 5 μL Buffer, mix well, react in a water bath at 37°C for 3 hours, and take all of them for agarose gel electrophoresis. The target gene was recovered with a DNA gel recovery kit.
[0060] 3 Double enzyme digestion and recovery of pGEX-4T-1 vector
[0061] The pGEX-4T-1 vector was digested with BamH I and Xho I, and the reaction system was as follows: 33 μL of pGEX-4...
Embodiment 3
[0074] Prokaryotic expression and purification of target genes
[0075] 1 Prokaryotic expression of the target gene
[0076] ⑴ Transformation of competent cells with recombinant expression vector
[0077] The correctly constructed expression vector plasmid was added to the prepared competent Rosetta (DE3). The sample volume was 0.5 μL, and the transformation process was as follows: ① Add the ligation product to BL21 (DE3) competent cells; ② Place in an ice bath for about 30 minutes; ③ Heat shock in a water bath at 42°C for 90 s, and cool in an ice bath for 2 minutes; ④ Transfer the bacterial solution to the container. 800 μl was preheated to 37°C in LB culture medium, and shaken at 37°C (120) for 1 hour to restore the drug resistance of the cells; ⑤ Spread 200 uL evenly on the LB agar plate containing the selection marker (Amp), and seal; ⑥ Invert the plate and incubate overnight in a 37°C incubator, and clones can be seen.
[0078] ⑵Recombinant protein SDS polyacrylamide...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com