Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Dirofilaria immitis enzyme-linked immunosorbent assay (ELISA) kit and preparation method thereof

A detection kit and Dirofilaria immitis technology, applied in the field of canine disease detection, can solve the problems of low microfilaria detection sensitivity, high requirements for equipment and reagents, labor-intensive and other problems, and achieve long storage time of reagents, Low equipment requirements and fast detection results

Inactive Publication Date: 2012-11-28
JILIN UNIV
View PDF6 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The invention discloses an ELISA detection kit for Dirofilaria imimaginum, which is used to detect whether canine animals are infected with Dirofilaria imimaginae, and solves the problems of low detection sensitivity, time-consuming and labor-intensive detection of microfilariae in blood, indirect fluorescent antibody tests and PCR and other methods have the disadvantages of high requirements for equipment and reagents, and can quickly and specifically detect the infection of Dirofilaria imimilis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dirofilaria immitis enzyme-linked immunosorbent assay (ELISA) kit and preparation method thereof
  • Dirofilaria immitis enzyme-linked immunosorbent assay (ELISA) kit and preparation method thereof
  • Dirofilaria immitis enzyme-linked immunosorbent assay (ELISA) kit and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Cloning of target gene

[0036] 1. According to the protective antigen gene MTFP gene sequence, design fragment amplification primers:

[0037] F2: 5'- GGATCC CAACTTACGCAGGAAGCA-3', the underline is the restriction site of BamH I;

[0038] S2: 5'- CTCGAG CTCGAGTTAGCAGTAATTGATGCC –3’, the Xho I restriction site is underlined.

[0039] 2. PCR amplification of the Dirofilaria immigatus MTFP gene

[0040] The PCR reaction system is: 5 μL of 10×buffer, 4 μL of dNTPs, 3 μL of DNA template, 0.5 μL of upstream primer and downstream primer, 0.5 μL of rTaq enzyme, and add water to 50 μL. Reaction conditions: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 2 min, annealing at 59°C for 1 min, extension at 72°C for 1 min, 30 cycles; final extension at 72°C for 10 min. The prepared phage genome containing the MTFP insert was amplified as a template. PCR products were identified by 1% agarose gel electrophoresis (see figure 1 ).

[0041] 3. Cloning of the gen...

Embodiment 2

[0055] Construction of recombinant expression vector

[0056] 1 Preparation of a large number of plasmids

[0057] Inoculate the recombinant bacteria transformed into DH5a with the correct recombinant cloning vector into Amp-containing LB liquid medium, culture in a 37°C incubator with shaking for 12 hours, and extract the plasmid with a large number of plasmid extraction kits from TaKaRa Company, according to the instructions.

[0058] 2. Gel recovery of enzyme-digested target gene

[0059] Add the following reagents in sequence: 2 μL restriction enzyme BamH I, 2 μL restriction enzyme Xho I, 41 μL DNA and 5 μL Buffer, mix well, react in a water bath at 37°C for 3 hours, and take all of them for agarose gel electrophoresis. The target gene was recovered with a DNA gel recovery kit.

[0060] 3 Double enzyme digestion and recovery of pGEX-4T-1 vector

[0061] The pGEX-4T-1 vector was digested with BamH I and Xho I, and the reaction system was as follows: 33 μL of pGEX-4...

Embodiment 3

[0074] Prokaryotic expression and purification of target genes

[0075] 1 Prokaryotic expression of the target gene

[0076] ⑴ Transformation of competent cells with recombinant expression vector

[0077] The correctly constructed expression vector plasmid was added to the prepared competent Rosetta (DE3). The sample volume was 0.5 μL, and the transformation process was as follows: ① Add the ligation product to BL21 (DE3) competent cells; ② Place in an ice bath for about 30 minutes; ③ Heat shock in a water bath at 42°C for 90 s, and cool in an ice bath for 2 minutes; ④ Transfer the bacterial solution to the container. 800 μl was preheated to 37°C in LB culture medium, and shaken at 37°C (120) for 1 hour to restore the drug resistance of the cells; ⑤ Spread 200 uL evenly on the LB agar plate containing the selection marker (Amp), and seal; ⑥ Invert the plate and incubate overnight in a 37°C incubator, and clones can be seen.

[0078] ⑵Recombinant protein SDS polyacrylamide...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a Dirofilaria immitis enzyme-linked immunosorbent assay (ELISA) kit for a dog, and a preparation method of the Dirofilaria immitis ELISA kit. Homologous genes are named methyl tri-fluoro pyruvate (MTFP) with homology of 88 percent, screened from a Dirofilaria immitis adult complementary deoxyribose nucleic acid (cDNA) expression library and used for encoding Brugia malayi myosin tail group proteins, MTFP proteins which are expressed in escherichia coli (E.coli) BL21(DE3) serve as antigens, and an indirect ELISA method for detecting the Dirofilaria immitis infection of the dog is established. The kit is high in specificity, high in sensitivity, high in accuracy and high in stability, has the advantages of simplicity in operation, quickness in detection, convenience for judgment and the like, and is suitable for clinical rapid diagnosis and large-scale application to epidemiological investigation in grassroots units, villages and the like.

Description

technical field [0001] The invention relates to a detection method for antibodies against Dirofilaria imimaginum infection, and further provides a detection kit for Dirofilaria imimaginum ELISA for dogs. The invention also discloses a preparation method of the kit, which belongs to the detection technology of canine diseases field. Background technique [0002] heartworm disease (Dirofilaria immitis) Adult worms parasitize in the right ventricle and pulmonary artery of dogs, causing mechanical embolism in dogs, affecting cardiopulmonary function, leading to respiratory failure, and severe damage to the circulatory and urinary systems. Dogs and felines are the natural hosts of the disease, and wild carnivores, equine animals, primates, etc. are occasionally infected, and can also infect humans. So far, heartworm disease has been prevalent in many countries in the world, including my country. Cases of human infection with heartworm have appeared in the United States, Canada...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/569
Inventor 张西臣侯洪烈李建华宫鹏涛张楠张国才杨举李赫陈玉江
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products