High-efficiency expression and purification method of aspergillus flavus uricase in Pichia pastoris

A high-efficiency expression technology of uric acid oxidase, which is applied in biochemical equipment and methods, botany equipment and methods, enzymes, etc., can solve the problems that the yield cannot reach industrial production, the difficulty of increasing purification, and the difficulty of extracellular secretion, etc., Achieve the effects of high medicinal value, low loss rate, and large industrialization prospects

Inactive Publication Date: 2013-06-19
HUBEI UNIV OF TECH
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Direct extraction in microorganisms is not conducive to purification, and the yield of the enzyme often does not meet the standards of industrial production
Expressed in prokaryotic systems, due to the lack of many subcellular structures in eukaryotic microorganisms, the enzyme activity is not as high as eukaryotic expression, and it is difficult to achieve extracellular secretion, which increases the difficulty of purification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-efficiency expression and purification method of aspergillus flavus uricase in Pichia pastoris

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Example 1: Construction of recombinant plasmid pPIC3.5K-α-factor-uricase secreting and expressing Aspergillus flavus uricase.

[0067] 1. Amplification of Uricase DNA sequence

[0068] After culturing Aspergillus flavus for 3 days, filter the bacterial liquid, collect mycelia, and extract total RNA from Aspergillus flavus mycelia according to the instructions of the Invitrogen Trizol RNA kit. Using the total RNA extracted from Aspergillus flavus mycelium as a template, urasoeupP1 (5'-TCCGCAGTAAAAGCAGCCCGCTACGGC-3') and urasoedownP2 (5'-AGCGAATTCTT ATTACAATTTAGACTTCAGAGAGGAC

[0069]CGGCC-3') was used as a primer, and RT-PCR amplification was performed according to the instructions of the RT-PCR kit of Promega Company. Separation by agarose gel electrophoresis (about 900bp), the reaction product was recovered with DNA Gel Extraction Kit to obtain U ricase DNA fragments.

[0070] 2. Acquisition of α-mating factor signal peptide DNA sequence (α-factor)

[0071] Using In...

Embodiment 2

[0084] Embodiment 2: the establishment of engineering bacteria

[0085] 1. Extraction and linearization of plasmid pPIC3.5K-α-factor-uricase

[0086] The pPIC3.5K-α-factor-uricase plasmid constructed in Example 1 was digested overnight with Sal I restriction endonuclease from TaKaRa Company for linearization.

[0087] 2. Electrotransformation of Pichia pastoris SMD1168

[0088] (1) Take 100 μL of the SMD1168 strain (purchased from Invitrogen) frozen at -70°C and inoculate 5 mL

[0089] In YPD medium, after culturing overnight at 30°C / 220rpm, streak on YPD solid medium,

[0090] Incubate at 30°C for 3 days.

[0091] (2) Pick a single colony and inoculate it in 10mL of YPD medium, shake it at 30°C / 220rpm overnight.

[0092] (3) Transfer 100mLYPD liquid culture medium with 1% inoculum amount, shake it overnight at 30°C / 220rpm, and stop the culture when the cell concentration is OD=1.3-1.5.

[0093] (4) Centrifuge at 2500g for 5min at 4°C, discard the supernatant, and resuspe...

Embodiment 3

[0108] Embodiment 3: engineering bacteria fermentation:

[0109] (1) The Pichia pastoris SMD1168 (pPIC3.5K-α-factor-uricase) strain of Example 2 was inserted into a 250ml shake flask containing 25ml of BMGY medium, and cultivated at 30°C / 250rpm until OD600=2-6;

[0110] (2) Centrifuge at 2500g for 5 minutes at room temperature, collect the bacteria, resuspend the bacteria in 1L of BMGY, and culture at 30°C / 250rpm until OD600=2-6;

[0111] (3) Centrifuge at 2500g for 5 minutes at room temperature, collect the bacteria, resuspend the bacteria in the shake flask with BMMY medium, adjust the OD600 to = 1.0, seal it with double gauze or cheesecloth, and place it at 28-30°C / 250 Continue growing on a shaker at -300rpm;

[0112] (4) Add 100% methanol to the medium every 24 hours to a final concentration of 1.0%, and cultivate for 72 hours to obtain the maximum concentration of soluble Aspergillus flavus uricase.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a high-efficiency expression and purification method of aspergillus flavus uricase in Pichia pastoris. The method comprises the steps of: on the basis of the nucleotide composition of an uricase gene, splicing the double-stranded DNA (DeoxyriboNucleic Acid) of the uricase and the double-stranded DNA of alpha-factor signal peptide via SOE-PCR (Splicing Overlap Extension-Polymerase Chain Reaction) to obtain a fusion gene alpha-factor-uricase; and inserting the fusion gene into plasmid pPIC3.5k to obtain recombinant plasmid pPIC3.5k-alpha-factor-uricase and carrying out electrotransformation on the Pichia pastoris to obtain high-expression clone strain Pichia pastoris SMD1168. The expressed recombined aspergillus flavus uricase has the advantages of completely natural N terminal, no any unnecessary amino acid, low production cost, high enzyme activity, simpleness and convenience in the purification step, high yield, high purity, easiness in industrial scale production and greater practical application value.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and specifically relates to a method for high-efficiency expression of Aspergillus flavus uricase in Pichia pastoris, and also relates to a method for purifying Aspergillus flavus uricase. Background technique [0002] Uric acid (also known as 2, 6, 8--trioxurine) is the final product of the metabolism of purine compounds in the human body. The blood uric acid level depends on the dynamic balance of uric acid production and excretion, and the saturation of plasma uric acid: 37 ℃, PH7 .4: 380-420 μmol / L (6.4-7.1 mg / dL). [0003] Uric acid is mostly decomposed by liver urate oxidase (uricase) to form allantoin, which is excreted in the urine. Human uric acid is an endogenous purine, which is the final degradation product through the action of xanthine oxidase in the liver and intestines. Exogenous purine is also an important source of uric acid. Domestic data show that the average male is ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/53C12N15/81C12N9/06
Inventor胡征杨波刘志刚
OwnerHUBEI UNIV OF TECH