High-efficiency expression and purification method of aspergillus flavus uricase in Pichia pastoris
A high-efficiency expression technology of uric acid oxidase, which is applied in biochemical equipment and methods, botany equipment and methods, enzymes, etc., can solve the problems that the yield cannot reach industrial production, the difficulty of increasing purification, and the difficulty of extracellular secretion, etc., Achieve the effects of high medicinal value, low loss rate, and large industrialization prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0066] Example 1: Construction of recombinant plasmid pPIC3.5K-α-factor-uricase secreting and expressing Aspergillus flavus uricase.
[0067] 1. Amplification of Uricase DNA sequence
[0068] After culturing Aspergillus flavus for 3 days, filter the bacterial liquid, collect mycelia, and extract total RNA from Aspergillus flavus mycelia according to the instructions of the Invitrogen Trizol RNA kit. Using the total RNA extracted from Aspergillus flavus mycelium as a template, urasoeupP1 (5'-TCCGCAGTAAAAGCAGCCCGCTACGGC-3') and urasoedownP2 (5'-AGCGAATTCTT ATTACAATTTAGACTTCAGAGAGGAC
[0069]CGGCC-3') was used as a primer, and RT-PCR amplification was performed according to the instructions of the RT-PCR kit of Promega Company. Separation by agarose gel electrophoresis (about 900bp), the reaction product was recovered with DNA Gel Extraction Kit to obtain U ricase DNA fragments.
[0070] 2. Acquisition of α-mating factor signal peptide DNA sequence (α-factor)
[0071] Using In...
Embodiment 2
[0084] Embodiment 2: the establishment of engineering bacteria
[0085] 1. Extraction and linearization of plasmid pPIC3.5K-α-factor-uricase
[0086] The pPIC3.5K-α-factor-uricase plasmid constructed in Example 1 was digested overnight with Sal I restriction endonuclease from TaKaRa Company for linearization.
[0087] 2. Electrotransformation of Pichia pastoris SMD1168
[0088] (1) Take 100 μL of the SMD1168 strain (purchased from Invitrogen) frozen at -70°C and inoculate 5 mL
[0089] In YPD medium, after culturing overnight at 30°C / 220rpm, streak on YPD solid medium,
[0090] Incubate at 30°C for 3 days.
[0091] (2) Pick a single colony and inoculate it in 10mL of YPD medium, shake it at 30°C / 220rpm overnight.
[0092] (3) Transfer 100mLYPD liquid culture medium with 1% inoculum amount, shake it overnight at 30°C / 220rpm, and stop the culture when the cell concentration is OD=1.3-1.5.
[0093] (4) Centrifuge at 2500g for 5min at 4°C, discard the supernatant, and resuspe...
Embodiment 3
[0108] Embodiment 3: engineering bacteria fermentation:
[0109] (1) The Pichia pastoris SMD1168 (pPIC3.5K-α-factor-uricase) strain of Example 2 was inserted into a 250ml shake flask containing 25ml of BMGY medium, and cultivated at 30°C / 250rpm until OD600=2-6;
[0110] (2) Centrifuge at 2500g for 5 minutes at room temperature, collect the bacteria, resuspend the bacteria in 1L of BMGY, and culture at 30°C / 250rpm until OD600=2-6;
[0111] (3) Centrifuge at 2500g for 5 minutes at room temperature, collect the bacteria, resuspend the bacteria in the shake flask with BMMY medium, adjust the OD600 to = 1.0, seal it with double gauze or cheesecloth, and place it at 28-30°C / 250 Continue growing on a shaker at -300rpm;
[0112] (4) Add 100% methanol to the medium every 24 hours to a final concentration of 1.0%, and cultivate for 72 hours to obtain the maximum concentration of soluble Aspergillus flavus uricase.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com