Human kallikrein of mammalian cell expression as well as coding gene and application thereof

A technology of kallikrein and coding genes, which is applied in the field of trace detection of recombinant proteins, can solve the problems of protein molecular weight and charge difference, low protein biological activity, high-efficiency expression, etc., and achieve the effect of high accuracy and sensitivity

Active Publication Date: 2014-04-09
ZONHON BIOPHARMA INST
View PDF2 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to species differences, it is difficult to express efficiently by transferring the natural gene sequence of human kallikrein into CHO
Lu et al. 1996 (Lu HS, etal Purification and characterization of human tissue prokallikrein and kallikrein isoforms expressed in Chinese hamster ovary cells. Protein Expr. Purif. 19968 (2): 227-237.) before expressing kallikrein in CHO Kallikrein (prokallikrein), after activation by thermolysin digestion, the obtained kallikrein hK1 has no obvious difference in activity compared with the natural product, but the hK1 protein is not uniform, and the protein molecular weight and charge are different; Li Tiyuan et al. 2002 (Expression of human tissue kallikrein gene in mammalian cells, China Biotechnology Journal, 200212(6):65-68) The constructed kallikrein with fluorescent protein gene was successfully expressed in CHO cells, However, the application value is not high, and the expression level is also low; a relatively similar study on the expression of hK1 protein using the CHO system is the hK1 protein prepared by Guangzhou Tianpu Biochemical Pharmaceutical Company (Chinese patent 201010198962.4), the expressed protein has low biological activity, and The amount of expression is far from meeting the production needs of industrialization
In addition, Guangzhou Tianpu Biochemical Pharmaceutical Co., Ltd. screened recombinant hK1 monoclonal host cells and seed culture in the early stage of recombinant hK1 production. The medium contained fetal bovine serum and introduced many animal-derived proteins, which had many potential risks; At the same time, in the process of expanding the preparation of recombinant hK1, serum-free medium is used. This form of preparation of recombinant hK1 is far from adapting to the development of the modern pharmaceutical industry.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human kallikrein of mammalian cell expression as well as coding gene and application thereof
  • Human kallikrein of mammalian cell expression as well as coding gene and application thereof
  • Human kallikrein of mammalian cell expression as well as coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0082] Example 1 Recombinant hK1 gene optimization design

[0083] 1. Codon optimization

[0084] Combining the published cDNA sequence information of human kallikrein-1 sequence (Homo sapiens kallikrein1) in GenBank and the amino acid sequence of the product human kallikrein-1 that has been on the market, the cDNA sequence was determined (GenBank accession number: BC005313) (A gene without codon optimization, the original gene) and the published amino acid sequence (GenBank accession number: AAA59455.1) of human kallikrein 1 (Homo sapiens kallikrein) obtained the present invention after codon optimization of the gene The recombinant hK1 gene, as shown in SEQ ID No: 1.

[0085] The following is the codon optimization of the recombinant hK1. The parameters before and after optimization are compared as follows:

[0086] 1. Codon Adaptation Index (CAI)

[0087] Depend on Figure 2-a It can be seen that before the codon optimization, the codon adaptation index (CAI) of the r...

Embodiment 2

[0098] Example 2: Construction of recombinant hK1 gene expression vector in mammalian cells

[0099] 1. Construction of recombinant hK1 gene expression vector in adherent mammalian cell CHO-K1

[0100] The optimized recombinant hK1 (as shown in SEQ ID NO: 1) was directly fused to the fragment synthesized by the optimized signal peptide gene of Rattus norvegicus Anionic trypsin-1 protein (as shown in SEQ ID No: 3), and constructed into pUC57 plasmid (Provided by Nanjing GenScript Technology Co., Ltd.), a long-term storage plasmid was obtained, which was designated as pUC57-opt-hK1 plasmid. Using the pUC57-opt-hK1 plasmid as a template, the upstream primer P1 was introduced into HindIII and the downstream primer P2 was introduced into the BamHI restriction site for PCR amplification. The sequences of the primers used are as follows:

[0101] Upstream primer P1: CCCAAGCTTGCCACCATGTCCG

[0102] Downstream primer P2: CGCGGATCCTCAACTGTTTTCAGCAAT

[0103] The total reaction volu...

Embodiment 3

[0109] Example 3: Preparation of CHO host cells containing optimized recombinant hK1 gene

[0110] 1. Preparation of CHO-K1 adherent host cells containing optimized recombinant hK1 gene

[0111] Spread an appropriate amount of CHO-K1 (CCL-61, purchased from ATCC) cells in 24-well plates, and then add different concentrations of G418 (E859-5G, purchased from Amresco) containing 5% FBS (FSP500, purchased from Jitai) Biological) DMEM / F12 (MD207-050, purchased from Merck) medium. After 2 weeks, the MTT (0793-5G, purchased from Amresco) method determined that the working concentration of G418 was between 400-800ug / mL, and the working concentration of G418 in this application was 600μg / mL, see Figure 7-a .

[0112] After the correctly sequenced pCMV13-opt-hK1 plasmid was electrotransfected into CHO-K1 cells, G418 medium containing a concentration of 600 μg / mL was added and placed at 37°C, 5% CO 2 incubator culture. After 2 weeks, multiple cell clusters appeared under the micr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Relative molecular massaaaaaaaaaa
Relative molecular massaaaaaaaaaa
Relative molecular massaaaaaaaaaa
Login to View More

Abstract

The invention relates to a human kallikrein-1 of mammalian cell expression, as well as a coding gene, an expressing method, a purifying process, a recombinant protein detecting method and application thereof. Kallikrein is serine protease, and plays a very important physiological role in human tissue. A conventional tissue extracting method has the problems of higher immunogenicity, or difficulty in source, insurmountability of virus contamination, and the like, and a common human kallikrein-1 of mammalian cell expression also has the defect of low expression quantity or lower activity. Therefore, the invention provides a coding gene for a recombinant hK1 as shown in SEQ ID NO:1, as well as a special expression, purification, recombinant protein detection method and application for the coding gene. Compared with the prior art, the recombinant hK1 provided by the invention is higher in expression quantity and activity; the purification process established by the invention and a drug detection method of the recombinant human kallikrein-1 lays the foundation in cell line development, process optimization, preclinical and clinical research and industrialized production in the drug development process.

Description

technical field [0001] The invention belongs to the field of bioengineering genes, and relates to human kallikrein-1 expressed by mammalian cells, a coding gene, an expression method and a purification process, as well as a micro-quantity detection method and application of recombinant protein. Background technique [0002] Kallikrein (KLK) is a serine protease that can cause kininogen to release kinin. It has high physiological activity and plays a very important physiological role in human tissues. Normally, kallikrein mostly exists as an inactive precursor. Kallikrein in the body is mainly divided into two categories: plasma kallikrein (Plasma Kallikrein) and tissue kallikrein (Tissue Kallikrein). The two enzymes differ in molecular size, substrate specificity, immunological profile, and kinin release. Plasma kallikrein is involved in clot surface activation, fibrinolysis, kininogenesis, and inflammatory processes. Tissue kallikrein is widely found in many tissues such...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/57C12N9/64C12N15/85C12N5/10C12P21/06C12Q1/37C12Q1/04
Inventor马永王安良孙芳范宇马骏徐春林陈晨王耀方
OwnerZONHON BIOPHARMA INST