Novel endoxylanase, and its encoding gene and application
A technology of xylanase and xylan, applied in the application, glycosylase, genetic engineering and other directions, can solve the problem that the physical and chemical properties, catalytic efficiency and yield of xylanase cannot be satisfied, and the physical and chemical properties, catalytic efficiency and yield cannot be satisfied. , low xylanase activity, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0150] Embodiment 1, the isolation of endo-1,4-beta-xylanase and its coding gene
[0151] Using metagenomic technology, a xylanase-positive clone was screened from the termite intestinal metagenome system by conventional methods, and the plasmid DNA of the clone was extracted for 454 high-throughput sequencing, and the complete Fosmid sequence could be obtained after sequence splicing. Use DNAStar software to search for ORF, use NCBI's BlastP (http: / / www.ncbi.nlm.nih.gov) to search the GenBank database, and obtain a new endo-1,4-β-xylanase coding gene, The gene has the nucleotide sequence of SEQ ID NO:1 and is named Xyl7. From the 1st-1518th nucleotide of the 5' end of SEQ ID NO:1 is the open reading frame (Open Reading Frame, ORF) of Xyl7, from the 1st-3rd nucleotide of the 5' end of SEQ ID NO:1 It is the start codon ATG of the Xyl7 gene, and the 1516-1518 nucleotides from the 5' end of SEQ ID NO:1 are the stop codon TAA of the Xyl7 gene.
[0152] The endo-1,4-β-xylanase ge...
Embodiment 2
[0155] Example 2, Expression of Xyl7 in Escherichia coli
[0156] 1. Construction of recombinant expression vector
[0157] The predicted endo-1,4-β-xylanase ORF coding gene was amplified from the xylanase-positive clones screened above by PCR, and the forward primer used was: 5'GAGACTCCATATGCAAGGTCCCACATGGACT3' (SEQ ID NO :3), its 5' end adds Nde I recognition site: CATATG; reverse primer is: 5'CGGAATTCTTACCTCACCATAACCCT3' (SEQ ID NO: 4), its 5' end adds EcoR I recognition site: GAATTC.
[0158] After the PCR product is purified, it is digested with Nde I and EcoR I, and the Axgen PCR product column recovery kit is used to reclaim the digested DNA fragment, and the DNA fragment and the recovered vector pET-28a (Novagen Company) through the same double digestion T4 DNA ligase was used to ligate overnight at 16°C to obtain the recombinant expression vector pET28a-Xyl7. There is a His tag (6×His-Tag) provided by the expression vector at the N-terminus of the expression product...
Embodiment 3
[0164] Example 3. Analysis of recombinant Xyl7 proteolytic properties
[0165] The enzyme activity of endo-1,4-β-xylanase was determined by DNS method, and the specific operation was as follows:
[0166] (1) DNS configuration
[0167] Weigh 10 grams of NaOH and dissolve in approximately 400ml ddH 2 O, then weigh 10g dinitrosalicylic acid, 2g phenol, 0.5g anhydrous sodium sulfite, 200g potassium sodium tartrate tetrahydrate, dissolve them in about 300ml ddH 2 O, mix the two solutions, dilute to 1 liter, and store in the dark.
[0168] (2) Standard curve preparation
[0169] Take 9 thin-walled centrifuge tubes, prepare xylose standard samples according to the xylose mother liquor volume and pure water volume described in Table 3, and the xylose mother liquor concentration is 10mg / ml.
[0170] table 3
[0171] Standard No.
1
2
3
4
5
6
7
8
9
Xylose content (μg)
0
10
20
30
40
70
80
120
150 ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 