Unlock instant, AI-driven research and patent intelligence for your innovation.

Plasmid for detecting activity of ribosome inactivating protein as well as construction method and application of plasmid

A technology for ribosome inactivation and protein activity, applied in the field of genetic engineering, can solve the problems of high cost, complicated steps, low sensitivity, etc., and achieve the effect of reducing cost, large application potential, and solving low sensitivity

Inactive Publication Date: 2015-04-08
SHANXI UNIV
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to provide a plasmid for detecting the activity of ribosome inactivating protein and its construction method and application for the problems of low sensitivity, complicated steps and high cost of the traditional method for detecting ribosome inactivating protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plasmid for detecting activity of ribosome inactivating protein as well as construction method and application of plasmid
  • Plasmid for detecting activity of ribosome inactivating protein as well as construction method and application of plasmid
  • Plasmid for detecting activity of ribosome inactivating protein as well as construction method and application of plasmid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1: psiCHECK TM - Construction of 2-F28RNA plasmid

[0025] According to the human 28S ribosomal sequence reported in GenBank as a template, primers were designed respectively upstream and downstream of the active site CGAGAG, F28F: CTCGAG AGCTCGCTTGATCTTGATTTTCA,F28R: CGCCGGCG TCTACGAATGGTTTAGCGCCA introduced Xho I and Not I restriction sites at the 5' and 3' ends respectively; the RNA of HCT116 cells was extracted by the Trizol method; the gene fragment F28RNA ( figure 1 ); the obtained gene fragment F28RNA and psiCHECK TM -2 plasmid was digested with restriction endonucleases Xho I and Not I, separated by 1% agarose gel electrophoresis, and the gene fragment F28RNA and psiCHECK were recovered TM -2 vector; use DNA ligase to convert the recovered gene fragment F28RNA and psiCHECK TM -2 vector for ligation, and the ligated product was transformed into Escherichia coli DH5α, after screening positive clones ( figure 2 ), a large amount of amplification was...

Embodiment 2

[0026] Example 2: Detection of ribosome inactivating protein activity in vitro

[0027] will psiCHECK TM- 1 μg of 2-F28RNA plasmid was dissolved in 10 μL of PBS buffer (pH 7), and buckwheat ribosome inactivating protein in different contents was added, incubated at 37° C. for 30 minutes, and detected by agarose gel electrophoresis. Ribosome inactivating protein activity was characterized by the amount of plasmid state transition from supercoiled to nicked loop (see image 3 ).

Embodiment 3

[0028] Example 3: Intracellular Detection of Ribosome Inactivation Protein Activity Detection

[0029] will psiCHECK TM - Dissolve 4 μg of 2-F28RNA plasmid in 400 μL of serum-free medium, add 8 μL of transfection reagent (TurboFect Transfection Reagent), and incubate at room temperature for 15 minutes; add the above mixed reagent to the cell culture well to be transfected in the cell culture medium, The cell abundance should reach more than 95%, and continue to culture at 37°C for about 24 hours; digest the transfected cells with trypsin, and distribute equal amounts into 3 wells, of which 1 μg and 5 μg are added to well 1 and 2 respectively For buckwheat ribosome inactivating protein, add an equal amount of PBS to the No. 3 well as a blank control group, and incubate at 37°C for about 12 hours; collect cells, lyse the cells with cell lysate, centrifuge to get the supernatant; take 20 μL of cell lysate, add to measure Add 100 μL firefly luciferase detection reagent to the bot...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a plasmid for detecting activity of ribosome inactivating protein as well as a construction method and application of the plasmid, and belongs to the technical field of genetic engineering. The plasmid comprises a gene fragment F28RNA with a recognition site of the ribosome inactivating protein, and the nucleotide sequence of the gene fragment is SEQ ID No.1. The plasmid is constructed by virtue of genetic engineering means including gene cloning, restriction enzyme digestion, connection, conversion and the like. The plasmid can be used for detecting the activity of the ribosome inactivating protein in vitro and in cells.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a plasmid for detecting the activity of a ribosome inactivating protein and a construction method and application of the plasmid. Background technique [0002] Ribosome-inactivating protein (RIP) widely exists in plants, can specifically destroy the function of ribosomes, inhibit protein biosynthesis, and plays an important role in plant resistance to pests and harsh environments. About 50 kinds of ribosome inactivating proteins have been found in 14 families including Cucurbitaceae, Euphorbiaceae, Poaceae and Caryophyllales. According to the primary structure of ribosome-inactivating protein, RIP can be divided into the following two types: type I, which consists of a polypeptide chain, has N-glycosidase activity, and has a highly conserved active site in the active site region And secondary structure, such as trichosanthin (TCS), pokeweed antiviral protein (PAP), s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/63C12N15/66C12Q1/68C12Q1/66
Inventor 崔晓东王转花吕彦
Owner SHANXI UNIV