Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Engineering bacteria for knocking out pyruvate formate-lyase genes and application of engineering bacteria

A technology of pyruvate formic acid and engineering bacteria, applied in the biological field, can solve the problems of reduced 1,3-propanediol production, waste of substrate glycerol, inhibition of cell growth, etc., and achieve the effects of reduced toxicity, reduced formic acid production, and increased rate

Active Publication Date: 2015-04-08
SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The generation of by-product organic acids not only inhibits cell growth, but also causes waste of substrate glycerol
For example, production of lactic acid results in lower production of 1,3-propanediol

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacteria for knocking out pyruvate formate-lyase genes and application of engineering bacteria
  • Engineering bacteria for knocking out pyruvate formate-lyase genes and application of engineering bacteria
  • Engineering bacteria for knocking out pyruvate formate-lyase genes and application of engineering bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1: Construction of a Klebsiella pneumoniae mutant strain in which the key gene of the formate metabolic pathway—pyruvate formate lyase flpB gene is inactivated.

[0023] (l), cloning the partial sequence of pyruvate formate lyase gene pflB

[0024] Design primers for PCR amplification of part of the gene sequence of pyruvate formate lyase flpB. The primer sequences are as follows: upstream primer pflB-F: taggtacctgaaagacaaattcgcccag and downstream primer pflB-R: gagagctccatgcgatccattacttcgt. Using the genomic DNA of wild-type Klebsiella pneumoniae (preserved in the China Center for Type Culture Collection, preservation number: CCTCC M 2011075) as a template, under the guidance of primers pflB-F and pflB-R, pyruvate was amplified by PCR For the partial sequence of formate lyase pflB, PCR amplification conditions are: first 95°C for 3 minutes; then 94°C for 1 minute, 50°C for 1 minute, 72°C for 1 minute, a total of 32 cycles; finally 72°C for 10 minutes. After th...

Embodiment 2

[0029] Example 2: Detection of activity of pyruvate formate lyase flpB gene in an insertionally inactivated Klebsiella pneumoniae mutant strain.

[0030] Carry out the activity detection of pyruvate formate lyase to the Klebsiella pneumoniae mutant strain whose flpB gene of pyruvate formate lyase flpB gene of embodiment 1 is inserted inactivated, with wild-type Klebsiella pneumoniae as a control, the specific method comprises The following steps:

[0031] (1) The Klebsiella pneumoniae mutant strain whose pyruvate formate lyase flpB gene is inactivated is inoculated in 100 mL of medium (every liter of water contains 20 g of glycerol, 10 g of tryptone, 5 g of yeast powder, 5 g of NaCl, pH 7.0, Sterilize at 120°C for 20 minutes), shake and culture at 37°C for 6-12 hours, and collect bacteria by sampling and centrifuging every 2 hours;

[0032] (2) Suspend and wash the bacteria twice with 100mL phosphate buffer (0.1M, pH7.5);

[0033] (3) Suspend the bacteria with 2.5mL phosphat...

Embodiment 3

[0037] Example 3: Fermentative production of 1,3-propanediol by Klebsiella pneumoniae mutant strain with knockout pyruvate formate lyase flpB gene

[0038] (1) culture medium

[0039] LB medium (g·L -1 ): yeast powder 5, peptone 10, NaCl 10, agar 10, adjusted to pH 7.0, for short-term preservation and activation of Klebsiella species. The composition of seeds and fermentation medium is shown in Table 1:

[0040] Table 1: Medium Composition

[0041]

[0042]

[0043] (2) Training method

[0044] (i) Seed activation: Klebsiella pneumoniae mutant strains and wild bacteria with knockout of the pyruvate formate lyase flpB gene preserved in glycerol tubes in Example 1 were respectively inoculated into LB medium for slant activation, at a temperature of 37° C. Incubate for 12 hours to activate the seeds.

[0045] (ii) Seed culture: 250mL triangular flask sealed with 9 layers of gauze, filled with 100mL of seed culture medium, inserted into the slant lawn (activated seeds o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses engineering bacteria for knocking out pyruvate formate-lyase genes and an application of the engineering bacteria. The pyruvate formate-lyase (flpB) genes in a wild-type strain for producing 1,3-propanediol are knocked out by utilizing a gene homologous recombination and gene insertional inactivation method, so that the gene engineering bacteria with blocked metabolic pathways of methanoic acid can be obtained. The engineering bacteria are used for fermenting production of 1,3-propanediol, and the synthesis of the byproduct methanoic acid is greatly reduced, so that the toxicity effect of the methanoic acid for cells can be reduced, and the concentration, production intensity and substrate conversion rate of the 1,3-propanediol can be improved. The experiment shows that when the engineering bacteria are fermented for 32h in a conventional method, the synthesis amount of the methanoic acid is reduced by more than 90 percent, and the concentration of the 1, 3-propanediol can reach more than 72g / L. By adopting the engineering bacteria, the progress of the technology for producing the 1,3-propanediol in the microorganism fermentation method can be promoted, and the application value can be realized.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an engineering bacterium for knocking out pyruvate formate lyase gene and application thereof. Background technique: [0002] 1,3-Propanediol (PDO) is an important chemical raw material with many important uses. It can be used to synthesize heterocycles, pharmaceutical intermediates, polyesters, lubricants, dyes, inks, antifreeze, etc., and its main use is to synthesize polyester-polytrimethylene terephthalate (PTT). PTT is a new fiber-forming polyester polymer material that has achieved industrial scale after polyethylene terephthalate (PET) in the 1950s and polybutylene terephthalate (PBT) in the 1970s. A very promising new polyester material. In 1998, PTT was rated as one of the six new petrochemical products by the United States. Compared with PET and PBT, PTT not only has the chemical resistance of polyester, but also has other more excellent characteristics. Suc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/74C12N1/21C12P7/18C12R1/22
Inventor 周胜秦启伟黄友华俞也频尼松伟
Owner SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com