An engineering bacterium for knocking out pyruvate formate lyase gene and its application

A pyruvate formic acid and lyase technology, applied in the biological field, can solve the problems of substrate glycerol waste, inhibition of cell growth, and reduced production of 1,3-propanediol, and achieve the effects of reduced formic acid production, reduced toxic effects, and improved levels

Active Publication Date: 2016-02-24
SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The generation of by-product organic acids not only inhibits cell growth, but also causes waste of substrate glycerol
For example, production of lactic acid results in lower production of 1,3-propanediol

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An engineering bacterium for knocking out pyruvate formate lyase gene and its application
  • An engineering bacterium for knocking out pyruvate formate lyase gene and its application
  • An engineering bacterium for knocking out pyruvate formate lyase gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1: Construction of a Klebsiella pneumoniae mutant strain in which the key gene of formic acid metabolism pathway-pyruvate formate lyase flpB gene is inactivated.

[0023] (l) Clone the partial sequence of pyruvate formate lyase gene pflB

[0024] Design primers for PCR amplification of part of the pyruvate formate lyase flpB gene sequence. The primer sequences are as follows: upstream primer pflB-F: taggtacctgaaagacaaattcgcccag and downstream primer pflB-R: gagagctccatgcgatccattacttcgt. Using wild-type Klebsiella pneumoniae (deposited in the Chinese Type Culture Collection, deposit number: CCTCCM2011075) genomic DNA as a template, under the guidance of primers pflB-F and pflB-R, PCR amplification pyruvate formic acid cleavage For the partial sequence of the enzyme pflB, the PCR amplification conditions are: first 95℃ for 3 min; then 94℃ for 1 min, 50℃ for 1 min, 72℃ for 1 min, a total of 32 cycles; finally 72℃ for 10 min. After the reaction, the PCR amplified produc...

Embodiment 2

[0029] Example 2: Detection of the activity of Klebsiella pneumoniae mutant strains in which the pyruvate formate lyase flpB gene was inserted and inactivated.

[0030] The Klebsiella pneumoniae mutant strain in which the pyruvate formate lyase flpB gene of Example 1 was inserted and inactivated was tested for the activity of pyruvate formate lyase. The wild-type Klebsiella pneumoniae was used as a control, and the specific methods included The following steps:

[0031] (l) Inoculate the Klebsiella pneumoniae mutant strain with inactivated pyruvate formate lyase flpB gene in 100 mL of medium (each liter of water contains 20 g of glycerol, 10 g of tryptone, 5 g of yeast powder, 5 g of NaCl, pH 7.0, Sterilize at 120°C for 20 minutes), culture with shaking at 37°C for 6-12 hours, and collect samples by centrifugation every 2 hours;

[0032] (2) Suspend and wash the bacteria twice with 100 mL phosphate buffer (0.1M, pH7.5);

[0033] (3) Use 2.5mL phosphate buffer (0.1M, pH7.5) to suspend...

Embodiment 3

[0037] Example 3: Fermentation of 1,3-propanediol by Klebsiella pneumoniae mutant strain knocked out of pyruvate formate lyase flpB gene

[0038] (1) Medium

[0039] LB medium (g·L -1 ): Yeast powder 5, peptone 10, NaCl10, agar 10, adjusted to pH 7.0, used for short-term preservation and activation of Klebsiella strains. See Table 1 for the composition of seeds and fermentation medium:

[0040] Table 1: Medium composition

[0041]

[0042]

[0043] (2) Training method

[0044] (i) Seed activation: Klebsiella pneumoniae mutant strains and wild bacteria that knocked out the pyruvate formate lyase flpB gene in Example 1 stored in glycerol tubes were respectively inoculated to the LB medium slope for activation, and the temperature was 37°C Cultivate for 12 hours to activate the seeds.

[0045] (ii) Seed culture: a 250mL Erlenmeyer flask is sealed with 9 layers of gauze, 100mL seed culture medium filled with liquid, connected to the slant moss (activated seed in step i), and aerobic seed c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses engineering bacteria for knocking out pyruvate formate-lyase genes and an application of the engineering bacteria. The pyruvate formate-lyase (flpB) genes in a wild-type strain for producing 1,3-propanediol are knocked out by utilizing a gene homologous recombination and gene insertional inactivation method, so that the gene engineering bacteria with blocked metabolic pathways of methanoic acid can be obtained. The engineering bacteria are used for fermenting production of 1,3-propanediol, and the synthesis of the byproduct methanoic acid is greatly reduced, so that the toxicity effect of the methanoic acid for cells can be reduced, and the concentration, production intensity and substrate conversion rate of the 1,3-propanediol can be improved. The experiment shows that when the engineering bacteria are fermented for 32h in a conventional method, the synthesis amount of the methanoic acid is reduced by more than 90 percent, and the concentration of the 1, 3-propanediol can reach more than 72g / L. By adopting the engineering bacteria, the progress of the technology for producing the 1,3-propanediol in the microorganism fermentation method can be promoted, and the application value can be realized.

Description

Technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to an engineered bacterium that knocks out the pyruvate formate lyase gene and its application. Background technique: [0002] 1,3-Propanediol (PDO) is an important chemical raw material with many important uses. It can be used to synthesize heterocycles, pharmaceutical intermediates, polyesters, lubricants, dyes, inks, antifreeze, etc. Its main use is to synthesize polyester-polytrimethylene terephthalate (PTT). PTT is a new fiber-forming polyester polymer material that has realized industrial scale after polyethylene terephthalate (PET) in the 1950s and polybutylene terephthalate (PBT) in the 1970s. A new type of polyester material with very promising development. In 1998, PTT was rated as one of the six new petrochemical products by the United States. Compared with PET and PBT, PTT not only has the chemical resistance of polyester, but also has other better characteristics. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/74C12N1/21C12P7/18C12R1/22
Inventor周胜秦启伟黄友华俞也频尼松伟
OwnerSOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI