Unlock instant, AI-driven research and patent intelligence for your innovation.

Pluripotent stem cell as well as preparation method and application thereof

A technology of pluripotent stem cells and stem cells, applied in the field of pluripotent stem cells and their preparation and application, can solve the problems of limited improvement of β-cell secretion function defects, achieve the effects of restoring immune balance, improving proliferation ability, and increasing expression

Inactive Publication Date: 2015-12-16
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional diabetes treatments, including insulin therapy, have only limited improvement in beta-cell secretory dysfunction

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pluripotent stem cell as well as preparation method and application thereof
  • Pluripotent stem cell as well as preparation method and application thereof
  • Pluripotent stem cell as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1C19o

[0043] Example 1C19orf80 gene synthesis experimental scheme (that is, the acquisition of human Betatrophin gene fragments)

[0044] 1: Design and synthesis of primers:

[0045] Use professional software to design primers for amplifying the Betatrophin gene sequence according to the synthesized Betatrophin gene sequence and the information of the adenovirus expression vector PRRLSIN_cPPT_PGKGFP_WPRE, and then send it to the relevant biological company (Shanghai Sangon Biological Co., Ltd.) for synthesis.

[0046] The primers used to amplify the Betatrophin gene sequence include a sense strand primer (ATGGGATCCATGCCAGTGCCTGCTCTGTGCCTG, SEQ ID NO: 1) and an antisense strand primer (ATGGTCGACTCAGGCTGGGAGCGCCGCTGTGTG, SEQ ID NO: 2). The restriction sites of forward and reverse primers are BamHI and SalI, respectively. Then the Betatrophin gene fragment was amplified by two rounds of PCR.

[0047] Two: PCR method to amplify the fragment (in two steps)

[0048] 1. Template splicin...

Embodiment 2

[0087] Example 2 Construction and packaging of recombinant adenoviral vector pAd.betatrophin

[0088] 1. Purpose: To construct a recombinant adenovirus vector carrying Betatrophin, and carry out packaging, identification, purification and titer determination, so as to lay the foundation for establishing a bone marrow mesenchymal stem cell line (ADMSC-BET) highly expressing Betatrophin.

[0089] 2. Materials

[0090] 3. Method:

[0091] A) Obtaining of Human Betatrophin Gene Fragment: Same as Example 1.

[0092] B) Construction of the expression vector containing the human Betatrophin gene fragment: because the previously used vector is a cloning vector, the human Betatrophin gene fragment needs to be cloned into the adenovirus expression vector pRRLSIN_cPPT_PGKGFP_WPRE. First, the pRRLSIN_cPPT_PGKGFP_WPRE (100ng / ul) vector was digested with BamHI / SalI, and the digestion system was as follows: PRRLSIN_cPPT_PGKGFP_WPRE plasmid 10ul, BamHI2ul, SalI2ul, 10×BamHIbuffer5ul, double...

Embodiment 3

[0095] Example 3: Construction of MSCs stably expressing Betatrophin protein and functional identification

[0096] 1. Purpose: To establish a method for the isolation and culture of human bone marrow mesenchymal stem cells in vitro; to observe the efficiency of recombinant adenovirus pAd.betatrophin infecting hMSCs and the expression of target genes. Establish adenovirus-transfected MSCs (ADMSC-BET) that can stably express betatrophin protein, and observe the effects on various functions of hMSCs cells.

[0097] 2. Method:

[0098] 1. Isolation, culture and identification of human bone marrow mesenchymal stem cells

[0099] For patients with closed femoral fractures, liver and kidney diseases, blood system and infectious diseases, tumors, etc. were excluded; after informed consent, 5ml of femoral bone marrow was taken when the patients underwent open reduction and internal fixation, and anticoagulated with heparin. The patient was from the Orthopedics Department of Shanghai...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biotechnologies, and in particular relates to a pluripotent stem cell as well as a preparation method and an application thereof. The pluripotent stem cell is a mesenchymal stem cell carrying a Betatrophin protein coding gene, shows typical characteristics of mesenchymal cells, can induce a transcription factor of a co-cultured islet cell for stably expressing beta cell specificity so as to improve the multiplication capacity of the islet cell and enhance the reaction, of the islet cell, for insulin secretion in response to excitation irritation of kcl and Arg; and meanwhile, the pluripotent stem cell is discovered to be capable of inhibiting inflammation and expression of an apoptosis factor, and increasing the expression of anti-inflammatory factors. The pluripotent stem cell, transplanted into an STZ-induced type-1 diabetic mouse model, has a significant treatment effect on a diabetic mouse.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a kind of pluripotent stem cell and its preparation and application. Background technique [0002] Diabetes is a complex metabolic disease. Currently, 285,000,000 adults worldwide have been diagnosed with diabetes, which has become a public health problem that seriously endangers human health. Diabetes is divided into type 1 diabetes, type 2 diabetes, gestational diabetes and special types of diabetes, of which T1DM and T2DM account for the vast majority. T1DM is caused by autoimmune-mediated destruction of pancreatic β-cell function. At the time of clinical diagnosis, the vast majority of pancreatic β-cells have lost their ability to secrete insulin. T2DM is caused by insulin resistance in peripheral tissues and the relative lack of insulin secretion. In both types of diabetes, a reduction in the number of beta cells that normally secrete insulin is a major factor in the developme...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N15/861A61K35/28A61P3/10
Inventor 孙亮亮蒋贝格刘天津石勇铨
Owner SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More