Pluripotent stem cell as well as preparation method and application thereof
A technology of pluripotent stem cells and stem cells, applied in the field of pluripotent stem cells and their preparation and application, can solve the problems of limited improvement of β-cell secretion function defects, achieve the effects of restoring immune balance, improving proliferation ability, and increasing expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1C19o
[0043] Example 1C19orf80 gene synthesis experimental scheme (that is, the acquisition of human Betatrophin gene fragments)
[0044] 1: Design and synthesis of primers:
[0045] Use professional software to design primers for amplifying the Betatrophin gene sequence according to the synthesized Betatrophin gene sequence and the information of the adenovirus expression vector PRRLSIN_cPPT_PGKGFP_WPRE, and then send it to the relevant biological company (Shanghai Sangon Biological Co., Ltd.) for synthesis.
[0046] The primers used to amplify the Betatrophin gene sequence include a sense strand primer (ATGGGATCCATGCCAGTGCCTGCTCTGTGCCTG, SEQ ID NO: 1) and an antisense strand primer (ATGGTCGACTCAGGCTGGGAGCGCCGCTGTGTG, SEQ ID NO: 2). The restriction sites of forward and reverse primers are BamHI and SalI, respectively. Then the Betatrophin gene fragment was amplified by two rounds of PCR.
[0047] Two: PCR method to amplify the fragment (in two steps)
[0048] 1. Template splicin...
Embodiment 2
[0087] Example 2 Construction and packaging of recombinant adenoviral vector pAd.betatrophin
[0088] 1. Purpose: To construct a recombinant adenovirus vector carrying Betatrophin, and carry out packaging, identification, purification and titer determination, so as to lay the foundation for establishing a bone marrow mesenchymal stem cell line (ADMSC-BET) highly expressing Betatrophin.
[0089] 2. Materials
[0090] 3. Method:
[0091] A) Obtaining of Human Betatrophin Gene Fragment: Same as Example 1.
[0092] B) Construction of the expression vector containing the human Betatrophin gene fragment: because the previously used vector is a cloning vector, the human Betatrophin gene fragment needs to be cloned into the adenovirus expression vector pRRLSIN_cPPT_PGKGFP_WPRE. First, the pRRLSIN_cPPT_PGKGFP_WPRE (100ng / ul) vector was digested with BamHI / SalI, and the digestion system was as follows: PRRLSIN_cPPT_PGKGFP_WPRE plasmid 10ul, BamHI2ul, SalI2ul, 10×BamHIbuffer5ul, double...
Embodiment 3
[0095] Example 3: Construction of MSCs stably expressing Betatrophin protein and functional identification
[0096] 1. Purpose: To establish a method for the isolation and culture of human bone marrow mesenchymal stem cells in vitro; to observe the efficiency of recombinant adenovirus pAd.betatrophin infecting hMSCs and the expression of target genes. Establish adenovirus-transfected MSCs (ADMSC-BET) that can stably express betatrophin protein, and observe the effects on various functions of hMSCs cells.
[0097] 2. Method:
[0098] 1. Isolation, culture and identification of human bone marrow mesenchymal stem cells
[0099] For patients with closed femoral fractures, liver and kidney diseases, blood system and infectious diseases, tumors, etc. were excluded; after informed consent, 5ml of femoral bone marrow was taken when the patients underwent open reduction and internal fixation, and anticoagulated with heparin. The patient was from the Orthopedics Department of Shanghai...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap