Microlunatus phosphovorus engineering strain capable of efficiently accumulating polyphosphate and application thereof

A technology of bacteria and bacteria strains, which is applied in the field of Phosphate-accumulating Lactella engineering bacteria that efficiently accumulates polyphosphate, to achieve the effects of high efficiency, improved performance, and reduced decomposition speed

Inactive Publication Date: 2016-03-02
SHANDONG JIANZHU UNIV +1
View PDF0 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The special role of PPK2 determines that the method of inactivating the ppk2 gene cannot be used to transform S. phosphate accumulating bacteria, and there is no report on obtaining high-performance S. phosphate accumulating bacteria by modifying the ppk2 gene promoter.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Microlunatus phosphovorus engineering strain capable of efficiently accumulating polyphosphate and application thereof
  • Microlunatus phosphovorus engineering strain capable of efficiently accumulating polyphosphate and application thereof
  • Microlunatus phosphovorus engineering strain capable of efficiently accumulating polyphosphate and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1: Continuous error-prone PCR obtains the ppk2 promoter containing mutant bases

[0034] The promoter of the ppk2 gene was mutated in vitro using serial error-prone PCR. Specifically:

[0035] 1. The primers for error-prone PCR are:

[0036] Sequence of upstream primer ppk2ProForward: GTCGAAATGTCGGAAGCCGTGC (SEQ ID NO.2);

[0037] The downstream primer ppk2ProReverse sequence: TAACCCATTGTTCGCCCGGCAG (SEQ ID NO.3).

[0038] (1) PCR reaction system: template DNA 2ul, PCR buffer 5ul, TaqDNA polymerase 1ul, dATP1~3ul, dTTP1~3ul, dGTP1~3ul, dCTP1~3ul, upstream primer 2ul, downstream primer 2ul, 25mMMgCl 2 1~8ul, 5mMMnCl 2 0~1ul, add ultrapure water to 50ul.

[0039] (2) PCR conditions: pre-denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 52-60°C for 30 seconds, extension at 72°C for 2 minutes, 30 cycles, and final extension for 8 minutes.

[0040]The template DNA of the first PCR was derived from S. phosphorus accumulativ...

Embodiment 2

[0042] Embodiment 2: Mutant library construction of Phosphorus acuminosa ppk2 gene promoter

[0043] The shuttle vector pMV306K carrying the upstream and downstream homology arms of the ppk2 gene was constructed, the continuous error-prone PCR products in Example 1 were separated by agarose gel electrophoresis, and the PCR products were recovered, and the above-mentioned shuttle vector pMV306K was recombined in vitro under the action of GibsonCloningMasterMix, Escherichia coli DH5a was transformed, and transformants were picked to extract plasmids for double enzyme digestion identification (pMV306K is a conventional plasmid in the prior art).

[0044] Prepare liquid medium according to the following formula: glucose 0.5g, peptone 0.5g, yeast powder 0.5g, sodium glutamate 0.5g, ammonium sulfate 0.1g, dipotassium hydrogen phosphate 0.44g, magnesium sulfate 0.1g, purified water 1L, pH7 .0, 0.15MPa sterilization for 30min. Each 250ml Erlenmeyer flask is filled with 50ml liquid me...

Embodiment 3

[0049] Example 3: Phosphorus accumulation activity screening of mutant strains

[0050] The recombinant bacterial strain constructed in Example 2 was cultivated to the logarithmic growth phase with the above-mentioned liquid medium (Example 2), and the bacterial cells were collected by centrifugation, washed with sterile water, and diluted to 10 8 Individual / ml, inoculate into new above-mentioned liquid culture medium according to 5% inoculum amount, each recombinant bacterial strain inoculates a 50ml / 250ml shaking flask. Cultivate on a shaker at 25°C and 200rpm for 48 hours, absorb 10ml of the bacterial liquid, centrifuge at 3000rpm for 10min to collect the bacterial cells, and measure the Poly-P content. Replace the remaining culture medium with sterile nitrogen to replace the air in the shaker flask, then seal the mouth of the bottle, continue to cultivate on a shaker at 25°C and 200rpm for 24 hours, absorb 10ml of bacterial solution, and centrifuge at 3000rpm for 10min to ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a microlunatus phosphovorus engineering strain capable of efficiently accumulating polyphosphate. The microlunatus phosphovorus engineering strain is microlunatus phosphovorus JN459-M571 and is preserved in the China General Microbiological Culture Collection Center with the preservation number of CGMCC No. 11770 on December 1, 2015. A continuous error-prone PCR method is adopted to mutate a promoter of a ppk2 gene in vitro, JN459 is used as a starting strain and a strain library containing the mutant of the promoter of the ppk2 gene is established through a gene recombination technology, and the JN459-M571 strain, of which, the capacity of decomposing polyphosphate under anaerobic conditions is reduced and the capacity of synthesizing polyphosphate under aerobic conditions has no significant difference, is obtained through screening. The Poly-P (polyphosphate) content of the strain disclosed by the invention is 2.4 times higher than that of an original strain JN459 in an anaerobic operation process and the strain disclosed by the invention can be applied to an EBPR (Enhanced biological phosphorus removal) process in a sewage treatment plant.

Description

technical field [0001] The invention belongs to the field of microbial breeding and biotechnology, and in particular relates to a Phosphate-accumulating engineering bacterium which efficiently accumulates polyphosphate and its application. Background technique [0002] At present, the problem of eutrophication in water bodies is quite serious. Studies have confirmed that phosphorus is one of the key factors causing eutrophication in water bodies. Therefore, reducing the content of phosphorus in the effluent of sewage treatment plants is an important measure to control eutrophication in water bodies. Currently, enhanced biological phosphorus removal (EBPR) is generally used in sewage treatment plants as the preferred biological phosphorus removal technology. The realization of the biological phosphorus removal function of EBPR depends on the phosphorus accumulation of phosphorus-accumulating microorganisms in activated sludge. Phosphorus-accumulating microorganisms are a gene...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/11C12N1/21C02F3/34C12R1/01C02F101/10
CPCC02F3/34C02F2101/105C12N1/20C12N15/11C12N15/113C12N1/205C12R2001/01Y02W10/37
Inventor钟传青曹广祥
OwnerSHANDONG JIANZHU UNIV