Method for increasing yield of L-alanyl-L-glutamine from recombinant escherichia coli

A glutamine and alanyl technology, applied in microorganism-based methods, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problem of affecting cell growth and metabolism, low substrate conversion rate, and instability of proglutamate dipeptide production strains. and other problems, to achieve the effect of improving enzyme catalytic efficiency, broad industrial application prospects, and improving substrate conversion rate and yield.

Inactive Publication Date: 2016-05-04
JIANGNAN UNIV
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although our research laboratory currently has the production strains of CG dipeptide and has been able to realize the microbial enzymatic preparation of CG dipeptide, we still face problems such as instability of CG dipeptide production strains, low yield, and low conversion rate of substrates.
Studies have reported that dipeptides are analogs of some cyclic antibiotics. Excessive accumulation of dipeptides in cells will affect the growth and metabolism of the cells themselves, thus making the strains unstable.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for increasing yield of L-alanyl-L-glutamine from recombinant escherichia coli
  • Method for increasing yield of L-alanyl-L-glutamine from recombinant escherichia coli
  • Method for increasing yield of L-alanyl-L-glutamine from recombinant escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Acquisition of genes encoding multidrug efflux transporters

[0036] Multidrug efflux transporter (ydeE) can specifically and effectively transport L-alanyl-L-glutamine from intracellular to extracellular, and a ydeE gene sequence (GeneID: 946083) published in NCBI was designed to For primer P1 (TTT GAATTC TTTAGCCCCCATACGACCAC), P2(TTT GGATCCTCAACAAAGCGCGGGCTGCC), using Escherichia coli genome as a template to carry out PCR amplification to obtain the target gene ydeE and its own promoter. The target gene ydeE and its own promoter were named NydeE. The P1 primer contains an EcorI restriction site, and the P2 primer contains a BamHI restriction site, which is convenient for subsequent restriction restriction and construction of vectors. The Escherichia coli genome was obtained through a bacterial genome DNA extraction kit purchased from Beijing Tiangen.

Embodiment 2

[0037] Embodiment 2: Obtaining of recombinant plasmid pET28a-NydeE containing NydeE

[0038] The NydeE target fragment obtained in Example 1 and the pET28a plasmid were simultaneously digested with EcorI and BamHI. The double enzyme digestion system is as follows:

[0039]

[0040] After 3 hours of double enzyme digestion, electrophoresis, gel cutting to recover the target fragment, T4 ligase ligation at 16°C for 12-16 hours. The connection system is as follows:

[0041]

[0042] After overnight ligation at 16°C, 3 μL of the ligation solution was transformed into Escherichia coli JM109 competent cells. The transformation process is as follows: add 3 μL of connection solution to 50 μL of JM109 competent cells, then add 10 μL of 5×KCM buffer, mix well, pre-cool on ice for 30 minutes, heat shock at 42°C for 90 seconds, and place on ice After standing still for 5 minutes, add 500 μL of LB medium, recover at 37°C, 220 rpm for 60 minutes. After resuscitation, take an appro...

Embodiment 3

[0043] Embodiment 3: Obtaining of recombinant plasmid pET21a-phoC-SAET containing SAET

[0044] The strain JM109 / pET21a-phoC-SAET containing the target plasmid stored in the laboratory was activated and cultured at 37°C and 220rpm for 12-16 hours. The cultured bacterial liquid was taken to extract the plasmid, and all operations were carried out in strict accordance with the instructions.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving activity of an L-alanyl-L-glutamine biosynthesis system containing recombinant DNA. A recombinant plasmid of the recombinant escherichia coli comprises an amino-acid ester acyltransferase encoding gene (SAET) which can catalyze L-glutamine and L-alanine methyl ester hydrochloride to generate L-alanyl-L-glutamine, and a multidrug efflux transporter protein encoding gene (ydeE) which can transporting L-alanyl-L-glutamine outside cells from cells, and due to co-expression of the two encoding genes, stability of a bacterium can be effectively improved, and the yield and the transformation rate of the bacterium can be increased. The recombinant plasmid is obtained by recombining SAET and ydeE with the same plasmid, or by co-transforming two recombinant plasmids with different resistances of two genes respectively. The yield of L-alanyl-L-glutamine of the recombinant bacterium can be increased by 3.33 times when compared with a conventional yield.

Description

technical field [0001] The invention discloses a method for improving the ability of recombinant Escherichia coli to produce L-alanyl-L-glutamine, which belongs to the field of microbial genetic engineering. Background technique [0002] L-alanyl-L-glutamine (L-alanyl-L-glutamine) is a dipeptide formed by the dehydration condensation of two amino acids, L-alanine and L-glutamine, referred to as L-glutamine dipeptide. As a conditionally essential amino acid, L-glutamine is widely used in the pharmaceutical industry. L-glutamine can be used as a raw material for gluconeogenesis and urea synthesis, a precursor of neurotransmitters, and an important intermediate of biochemical metabolic pathways in vivo. Due to its physical and chemical properties different from L-glutamine, glutamine overcomes the disadvantages of L-glutamine's low solubility and thermal instability, so it is often used as a substitute for L-glutamine in the form of injections And applied clinically. [0003...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/70C12N15/67C12P21/02C12R1/19
CPCC07K14/245C07K5/06026C12N9/1029C12N15/67C12N15/70C12N2800/101
Inventor张震宇魏照辉
OwnerJIANGNAN UNIV