Corynebacterium glutamicum and method for overproduction of phosphatidylserine by means of corynebacterium glutamicum

A technology of phosphatidylserine and Corynebacterium glutamicum, which is applied in the fields of metabolic engineering and fermentation engineering, can solve the problems of low PS content, slow growth of yeast, difficulty in extracting high-purity PS, etc., and achieve the effect of increasing yield

Active Publication Date: 2016-05-25
TIANJIN UNIV OF SCI & TECH
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The extraction method mainly uses organic solvents to extract PS from animal and plant materials, but this method has many limiting factors
The animal extraction method mainly extracts PS from bovine brain and viscera, but it has been questioned due to unsafe diseases such as mad cow disease; the content of PS in plants is low, the extraction amount is low, and it is difficult to extract high-purity PS, which increases the cost of separation and purification , causing PS prices to remain high
Compared with the extraction method, the bio-enzyme method uses phosphatidylcholine as a substrate, adds L-serine, and generates phosphatidylserine (PS) under the action of phospholipase D (PLD). The reaction conditions of this method are mild, and the product The security level is high, but the production cost of PLD is high and it is not easy to obtain, which has become the main bottleneck of PS production
[0004] As one of the phospholipid components, PS exists in microorganisms. Therefore, the use of genetic engineering to obtain an engineering strain with high PS synthesis provides a new idea for the preparation of PS. Escherichia coli and yeast have been reported to extract phospholipids, but E. coli It is not a food-safe strain, and yeast also limits its industrialization due to its slow growth

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Corynebacterium glutamicum and method for overproduction of phosphatidylserine by means of corynebacterium glutamicum
  • Corynebacterium glutamicum and method for overproduction of phosphatidylserine by means of corynebacterium glutamicum
  • Corynebacterium glutamicum and method for overproduction of phosphatidylserine by means of corynebacterium glutamicum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] The construction of embodiment 1 Corynebacterium glutamicum sdaA deletion strain

[0047] (1) Construction of sdaA deletion plasmid

[0048] 1) Design two pairs of primers according to the sequence of the sdaA gene of Corynebacterium glutamicum in NCBI, and obtain the upstream 703bp fragment and the downstream 701bp fragment of the sdaA gene by PCR method, and design two pairs of primers as follows:

[0049] sdaAL-F: 5'— GGAATTCC ATTGCGGCATCTGCTGG—3'

[0050] sdaAL-R: 5'—CCGGTACCCGGGCTGAGGGTGGGCC—3'

[0051] sdaAR-F: 5'—CCCTCAGCCCGGTACGGCTTTAACACG—3'

[0052] sdaAR-R: 5'— GCTCTAGA GCTACACCGCTTGATCGCA—3'

[0053] 2) Using high-fidelity Pyrobest DNA polymerase, using the left and right homology arms as templates, the modified fragment △sdaA with the deletion of the sdaA gene was amplified by overlapping PCR;

[0054] 3) Ligate the recovered 1387bp target fragment ΔsdaA with pK18mobsacB treated with the same enzyme digestion to obtain pK18mobsacB ΔsdaA, and transfo...

Embodiment 2

[0060] Example 2C. glutamicum(ΔsdaA) / pXMJ19-pssA-serA Δ197 - Construction of cdsA

[0061] 1. Expression plasmid pXMJ19-pssA-serA Δ197 - Construction of cdsA

[0062] 1) Using the PCR method to amplify the pssA gene using E.coliK12 genomic DNA as a template.

[0063] 2) The purified PCR product was double-digested with XbaI and EcoRI and connected to the expression vector pXMJ19 containing the same restriction site to construct the recombinant plasmid pXMJ19-pssA.

[0064] 3) The recombinant plasmid was transformed into E.coliJM109 competent cells, a single colony was picked and cultured on chloramphenicol-resistant LB medium, and the extracted plasmid was identified by double digestion with XbaI and EcoRI.

[0065] 4) using the PCR method to amplify serA with the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template Δ197 Gene fragment.

[0066] 5) The purified PCR product was double-digested with BamHI and EcoRI and connected to the expression vector pXMJ19-p...

Embodiment 3

[0080] The codon optimization of embodiment 3pssA gene

[0081] In order to further increase the expression of pssA gene in C. glutamicum, the codon optimization of pssA gene was carried out. The relevant design principles are as follows: (1) Analyze the frequency of degenerate codons in the pssA gene and C. glutamicum, and select the most preferred codons first, and some secondary preferred codons can also be used; (2) The amino acid sequence of the original pssA gene cannot Change.

[0082] Comparison of the nucleotide sequence between the optimized pssAM and the original pssA, the codon optimization of the pssA gene has changed a total of 275 bases, accounting for 20.3% of the total bases of the pssA gene, and the expression of PS in Corynebacterium glutamicum has increased more than 15%.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of metabolic engineering and fermentation engineering, and particularly relates to a corynebacterium glutamicum strain and a method for overproduction of phosphatidylserine by means of the corynebacterium glutamicum strain to solve the problems of the prior art that production cost is high and phosphatidylserine is hard to obtain by means of the enzymic method. The corynebacterium glutamicum genetically engineered bacterium is obtained by knocking out the sdaA gene in a corynebacterium glutamicum host cell for expressing L-serine deaminase, and conducting co-expression of the expression gene of phosphatidylserine synthase pssA gene, the mutant gene of 3-phosphoglycerate dehydrogenase serA delta 197 gene, and the expression gene of CDP-diglyceride synthetase cdsA gene. The yield of phosphatidylserine prepared with the strain fermentation method is increased by 17-39% compared with the original strain.

Description

Technical field: [0001] The invention belongs to the technical field of metabolic engineering and fermentation engineering, and particularly relates to a strain of Corynebacterium glutamicum and a method for excessively synthesizing phosphatidylserine. Background technique: [0002] Phosphatidylserine (PS) widely exists in the biofilms of animals, plants and microorganisms, and is an important phospholipid component. The content of PS in the phospholipids of animal tissues is very low, only 2% to 10% of the total phospholipids. PS cannot be completely synthesized by itself in the human body, and it is mainly absorbed by external food. Although the content is low, it has important physiological functions. PS can help brain cells store and read data, affect the transmission of chemical information in the brain, and is an important nutrient element for maintaining normal brain responses and healthy emotions. PS has a good effect on the treatment of Alzheimer's disease, ADHD an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N9/12C12N15/54C12N15/77C12P13/06C12R1/15
CPCC12N9/0006C12N9/1241C12N9/1288C12N9/88C12P7/6481C12P13/06C12Y101/01008C12Y207/07041C12Y207/08008C12Y403/01017
Inventor刘逸寒路福平李瑞
OwnerTIANJIN UNIV OF SCI & TECH