An enzyme-linked immunosorbent assay kit for the detection of Chlamydia psittaci
An ELISA detection technology for Chlamydia psittaci, which is applied in the field of ELISA detection kits for Chlamydia psittaci, can solve the problems that the result judgment is greatly affected by subjective factors, prone to false positives, and cumbersome test operations, etc. Achieve good market prospects, reduce the influence of subjective factors, and have good sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] Example 1 Preparation of recombinant protein MOMP
[0061] 1. Extract the total DNA of Chlamydia psittaci 6BC strain (DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.)
[0062] 1) Take 100 μL of the purified product of Chlamydia psittaci 6BC strain, add 200 μL of buffer GA, and shake to mix.
[0063] 2) Add 20 μL of Proteinase K solution, vortex and mix, then add 200 μL of buffer GB, fully invert and mix, place at 70°C for 10 minutes, and briefly centrifuge.
[0064] 3) Add 200 μL of absolute ethanol, shake and mix well for 15 sec, when a flocculent precipitate appears, briefly centrifuge.
[0065] 4) Add the solution and flocculent precipitate obtained in the previous step into an adsorption column CB3 (the adsorption column is placed in a collection tube), centrifuge at 12000 rpm for 30 sec, discard the waste liquid, and put the adsorption column CB3 back into the collection tube.
[0066] 5) Add 500 μL buffer GD (absolute eth...
Embodiment 2
[0090] Embodiment 2 The selection of antigen protection agent
[0091] Selection - sucrose, trehalose, β-1,3 / 1,6 glucan, polyethylene glycol 6000, glycerin, gelatin were prepared as antigen protection agent according to the formula in Table 1, and the Chlamydia MOMP was coated with the optimal conditions Add 200 μL / well antigen stabilizer (prescription 1, prescription 2, prescription 3, prescription 4, PBS control group) to the protease label plate after sealing and washing, overnight at 4°C, take out the next day, discard the liquid in the well, and add PBST Solution 300 μL / well, wash 3 times, 3 minutes each time, pat dry with absorbent paper, irradiate with ultraviolet light for 2 hours, put it in a light-proof bag after drying, store at 37°C for 7 days, take out 4 wells every day and place at 4°C environment. On the 12th day, take out all the microplates, and take out the microplates stored at -20°C (-20°C control group), detect the positive control substance according to ...
Embodiment 3
[0097] Example 3 Preparation of an ELISA plate coated with Chlamydia psittaci recombinant protein MOMP
[0098] 1. Using the total DNA of Chlamydia psittaci 6BC strain as a template, use specific primers MOMP-F and MOMP-R to amplify to obtain a 1143bp target fragment, the nucleotide sequence of which is shown in SEQ ID NO.2;
[0099] MOMP-F: AAAGAATTCTTGCCTGTAGGGAACCC;
[0100] MOMP-R: GGGGTCGACTTAGAATCTGAATTGAG;
[0101] 2. Recover and purify the amplified fragment, and then use EcoRlI and SalI double enzyme digestion to recover and purify the target fragment;
[0102] 3. Ligate the digested target fragment with the PET28a(+) vector cut with the same enzyme to obtain a recombinant expression plasmid;
[0103] 4. Transform the recombinant plasmid into Escherichia coli BL21(DE3), culture at 37°C, and induce expression with IPTG;
[0104] 5. Centrifuge the bacterial solution to collect the precipitate, redissolve the precipitate in PBS, pH 7.2 solution, and then centrifuge to...
PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com