Supercharge Your Innovation With Domain-Expert AI Agents!

An enzyme-linked immunosorbent assay kit for the detection of Chlamydia psittaci

An ELISA detection technology for Chlamydia psittaci, which is applied in the field of ELISA detection kits for Chlamydia psittaci, can solve the problems that the result judgment is greatly affected by subjective factors, prone to false positives, and cumbersome test operations, etc. Achieve good market prospects, reduce the influence of subjective factors, and have good sensitivity

Active Publication Date: 2017-06-20
CHINA AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The complement fixation test is cumbersome to operate, has low sensitivity, takes a long time to detect, and requires high professional knowledge, so it is subject to more restrictions in clinical application
[0008] The operation procedure of the indirect hemagglutination test method is simple and does not require special equipment, but the result judgment is greatly affected by subjective factors, and most of the coupled antigens are whole bacteria, which may have cross-reaction with some Gram-negative bacteria, and the results are prone to false positives
The colloidal gold test strip method is simple and easy to operate, but the detection sensitivity is low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An enzyme-linked immunosorbent assay kit for the detection of Chlamydia psittaci
  • An enzyme-linked immunosorbent assay kit for the detection of Chlamydia psittaci
  • An enzyme-linked immunosorbent assay kit for the detection of Chlamydia psittaci

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Example 1 Preparation of recombinant protein MOMP

[0061] 1. Extract the total DNA of Chlamydia psittaci 6BC strain (DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.)

[0062] 1) Take 100 μL of the purified product of Chlamydia psittaci 6BC strain, add 200 μL of buffer GA, and shake to mix.

[0063] 2) Add 20 μL of Proteinase K solution, vortex and mix, then add 200 μL of buffer GB, fully invert and mix, place at 70°C for 10 minutes, and briefly centrifuge.

[0064] 3) Add 200 μL of absolute ethanol, shake and mix well for 15 sec, when a flocculent precipitate appears, briefly centrifuge.

[0065] 4) Add the solution and flocculent precipitate obtained in the previous step into an adsorption column CB3 (the adsorption column is placed in a collection tube), centrifuge at 12000 rpm for 30 sec, discard the waste liquid, and put the adsorption column CB3 back into the collection tube.

[0066] 5) Add 500 μL buffer GD (absolute eth...

Embodiment 2

[0090] Embodiment 2 The selection of antigen protection agent

[0091] Selection - sucrose, trehalose, β-1,3 / 1,6 glucan, polyethylene glycol 6000, glycerin, gelatin were prepared as antigen protection agent according to the formula in Table 1, and the Chlamydia MOMP was coated with the optimal conditions Add 200 μL / well antigen stabilizer (prescription 1, prescription 2, prescription 3, prescription 4, PBS control group) to the protease label plate after sealing and washing, overnight at 4°C, take out the next day, discard the liquid in the well, and add PBST Solution 300 μL / well, wash 3 times, 3 minutes each time, pat dry with absorbent paper, irradiate with ultraviolet light for 2 hours, put it in a light-proof bag after drying, store at 37°C for 7 days, take out 4 wells every day and place at 4°C environment. On the 12th day, take out all the microplates, and take out the microplates stored at -20°C (-20°C control group), detect the positive control substance according to ...

Embodiment 3

[0097] Example 3 Preparation of an ELISA plate coated with Chlamydia psittaci recombinant protein MOMP

[0098] 1. Using the total DNA of Chlamydia psittaci 6BC strain as a template, use specific primers MOMP-F and MOMP-R to amplify to obtain a 1143bp target fragment, the nucleotide sequence of which is shown in SEQ ID NO.2;

[0099] MOMP-F: AAAGAATTCTTGCCTGTAGGGAACCC;

[0100] MOMP-R: GGGGTCGACTTAGAATCTGAATTGAG;

[0101] 2. Recover and purify the amplified fragment, and then use EcoRlI and SalI double enzyme digestion to recover and purify the target fragment;

[0102] 3. Ligate the digested target fragment with the PET28a(+) vector cut with the same enzyme to obtain a recombinant expression plasmid;

[0103] 4. Transform the recombinant plasmid into Escherichia coli BL21(DE3), culture at 37°C, and induce expression with IPTG;

[0104] 5. Centrifuge the bacterial solution to collect the precipitate, redissolve the precipitate in PBS, pH 7.2 solution, and then centrifuge to...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention relates to a detection kit, and specifically discloses a kit for detecting avian chlamydia psittaci by enzyme linked immunosorbent assay. A genetic engineering expression recombinant protein MOMP is used as an antigen for wrapping a solid-phase carrier for enzyme linked immunosorbent assay adsorption detection. By the adoption of genetic engineering expression high-purity recombinant antigen as a wrapping antigen, the kit is high in specificity and high in sensitivity. After wrapping the solid-phase carrier, the antigen is protected with an antigen protector, so that the storage time of the antigen is prolonged. Furthermore, an enzyme linked antibody used in the kit is horse radish peroxidase-marked rabbit-anti bird IgG and can be widely used for detecting the universality of poultry such as chickens, ducks and gooses.

Description

technical field [0001] The invention relates to a detection kit, in particular to an ELISA detection kit for Chlamydia psittaci. Background technique [0002] Avian Chlamydiosis (Avian Chlamydiosis) is a kind of zoonotic infectious disease caused by Chlamydia psittaci (Cp) in poultry, birds and mammals. It often manifests as poultry respiratory and digestive tract disease symptoms, infected poultry lethargy, fever, weight loss, abnormal nasal and eye secretions, air sacitis, peritonitis, pericarditis, perihepatitis, and egg production of laying poultry decreased. Up to 30%; ornamental birds showed symptoms such as loss of appetite, weight loss, diarrhea, yellow feces, sinusitis, respiratory inflammation, hepatosplenomegaly, air sacitis, pericarditis, peritonitis after infection. Occasionally, the disease also infects cattle, sheep and other mammals, causing symptoms such as inflammatory lesions of the reproductive tract of animals and abortion of pregnant animals. Humans c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N33/68G01N33/569G01N33/543
CPCG01N33/543G01N33/56927G01N33/68G01N2333/95
Inventor 何诚吴宗学张强
Owner CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More