Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Chlorotoxin polypeptide-ferritin heavy chain fusion protein, self-assembled protein nanocage and its preparation method and application

A technology of ferritin heavy chain and chlorotoxin, applied in the field of genetic engineering, can solve the problems of weakened biological activity, insufficient stability, poor pharmacokinetics and the like

Active Publication Date: 2019-10-22
SHENZHEN INST OF ADVANCED TECH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The stability of the polypeptide itself is not enough, the yield is low, and the pharmacokinetics is poor when it is directly used for treatment. However, when coupled with inorganic nanomaterials, it is easy to cause the denaturation of the polypeptide and weaken the biological activity in the process.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chlorotoxin polypeptide-ferritin heavy chain fusion protein, self-assembled protein nanocage and its preparation method and application
  • Chlorotoxin polypeptide-ferritin heavy chain fusion protein, self-assembled protein nanocage and its preparation method and application
  • Chlorotoxin polypeptide-ferritin heavy chain fusion protein, self-assembled protein nanocage and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0095] Embodiment 1: molecular design CHF gene

[0096] A. Design primers: Using the human iron protein nanocage heavy chain in the human genome cDNA library as a template, design 2 primers to amplify the HFt gene by PCR, and the forward primer is primer HFP1:TTA GGATCC ATGACCACCGCGAGCACCA (SEQUENCENO.13), the forward primer is primer HFP2: TTA CTCGAG GCTTTCGTTATCGCTATCGCCC (SEQUENCE NO. 14). In addition, two PCR amplification primers were designed for PCR amplification to obtain the CTX gene, and the forward primer was primer CP1: TTA CCATGG GCATGTGTATGCCGTGCTTCACTACCGATCA (SEQUENCE NO.15), the reverse primer is primer CP2: TTA GGATCC ACGGCACAGACACTGCGGACCGT (SEQUENCE NO. 16).

[0097] B. PCR amplification to obtain the HFt gene: 5 microliters of 10xTaq polymerase buffer, 4 microliters of dNTP mixture, 1 microliter of primer HFP1, 1 microliter of primer HFP2, and 1 microliter of template (cloning to obtain plasmid Template, the amino acid sequence is:

[0098]MTTASTS...

Embodiment 2

[0101] Embodiment 2: Construction of CHF protein nanocage recombinant expression vector

[0102] A: Double digestion and ligation of HFt, CTX gene and pET-28a vector

[0103] The PCR product obtained in Example 1 was extracted with phenol:chloroform:isoamyl alcohol (25:24:1), precipitated with absolute ethanol (2.5 volumes), and then dissolved with 50 μl of sterile water. The recovered PCR product and expression vector pET-28a plasmid were digested with restriction endonucleases BamHI and HindIII (products of Takara Company). Digestion reaction: 1 μl each of BamHI (14U / μl) and HindIII (20U / μl), 2.5 μl of 10-fold buffer, 50-100 ng of PCR product or pET-28a plasmid, and sterile water to a total volume of 25 μl. 37 ℃ water bath for 5 hours, the digested product was extracted with phenol: chloroform: isoamyl alcohol, precipitated with absolute ethanol (2.5 times volume) and washed with T 4 DNA ligase (product of Takara Company) ligated the PCR product to the expression vector pE...

Embodiment 3

[0110] Embodiment 3: the preparation of recombinant CHF genetically engineered bacteria

[0111] The positive clones sequenced correctly in step 2C of Example 2 were extracted by the alkaline lysis method to extract the recombinant expression plasmid pET-28a-CHF (see the second edition of "Molecular Cloning" for the method). The extracted pET-28a-CHF plasmid was transformed into Escherichia coli competent BL21 (DE3) cells prepared in the step of Example 2B according to the transformation method in the step of Example 2C. Tablet is LB / Kan + Agar plates. Single clones were picked to obtain genetically engineered bacteria BL21(DE3)(pET-28a-CHF).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
diameteraaaaaaaaaa
particle diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides a scorpion chlorotoxin polypeptide-ferritin heavy chain fused protein, a self-assembled protein nanocage, a preparation method therefor and application. According to the technical scheme provided by the invention, by using biomedical functions and own structural characteristics of scorpion chlorotoxin polypeptide and human heavy-chain ferritin, the scorpion chlorotoxin polypeptide and the human heavy-chain ferritin are designed into the fused protein by adopting a genetic engineering method, and the fused protein nanocage with bioactivity is formed, so that the stability and bioavailability of the scorpion chlorotoxin polypeptide are improved, the targeted glioma resisting function is enhanced.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a chlorotoxin polypeptide-ferritin heavy chain fusion protein, a self-assembled protein nanocage and a preparation method and application thereof. Background technique [0002] Glioma, also referred to as glioma, is a primary intracranial tumor originating from glial cells. Malignant glioma has a high lethality rate, and the early boundary is not obvious. It is difficult to effectively treat it with existing treatments. diagnosis and treatment. [0003] The study found that the neurotoxin polypeptide Chlorotoxin (CTX) extracted from the venom of the Israeli golden scorpion, a small peptide with only 36 amino acids, can inhibit the glioma-specific chloride ion channel, and then found that the recombinantly expressed CTX can pass through the The combination of matrix metalloproteinase (matrix metalloproteinase-2, MMP-2) on the surface of tumor cells can specifically target gliom...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C12P21/02C12N15/70C12N1/21A61K38/17A61K47/64A61P35/00
Inventor 蔡林涛孙正博张雯璐龚萍
Owner SHENZHEN INST OF ADVANCED TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com